Review



sgrna targeting pdcd1  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Addgene inc sgrna targeting pdcd1
    Sgrna Targeting Pdcd1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+targeting+pdcd1/sgrna+targeting+pdcd1/pm34879274-249-86-87
    Average 90 stars, based on 1 article reviews
    sgrna targeting pdcd1 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    RNA Sequencing:

    Article Title: Genome-wide fitness gene identification reveals Roquin as a potent suppressor of CD8 T cell expansion and anti-tumor immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DAPI BioLegend Cat#422801 LIVE/DEAD Fixable Near-IR Dead Cell Stain Invitrogen Cat#L34976 Biotin anti-mouse Thy1.1 (OX-7) BioLegend Cat#202510, RRID: AB_2201417 PE anti-mouse Thy1.1 (OX-7) BioLegend Cat#202524, RRID: AB_1595524 APC anti-mouse CD8a (53-6.7) BioLegend Cat#100712, RRID: AB_312751 eFluor 450 anti-mouse CD8a (53-6.7) Invitrogen Cat#48-0081-82, RRID: AB_1272198 PE anti-mouse CD8a (53-6.7) BioLegend Cat#100708, RRID: AB_312747 PE-Cy7 anti-mouse CD8a (53-6.7) Invitrogen Cat#25-0081-82, RRID: AB_469584 PE anti-mouse CD45.2 (104) Invitrogen Cat#12-0454-83, RRID: AB_465679 Brilliant Violet 785 anti-mouse CD45.1 (A20) BioLegend Cat#110743, RRID: AB_2563379 PE anti-mouse ICOS (C398.4A) BioLegend Cat#313508, RRID: AB_416332 FITC anti-mouse CD25 (PC61) BioLegend Cat#102006, RRID: AB_312855 FITC anti-mouse PD-1 (29F.1A12) BioLegend Cat#135214, RRID: AB_10680238 PE anti-mouse PD-1 (29F.1A12) BioLegend Cat#135206, RRID: AB_1877231 PE-Cy7 anti-mouse TIM-3 (RMT3-23) Invitrogen Cat#25-5870-82, RRID: AB_2573483 PerCP-eFluor 710 anti-mouse LAG-3 (C9B7W) Invitrogen Cat#46-2231-82, RRID: AB_11151334 PE-Cy7 anti-mouse CD62L (MEL-14) Invitrogen Cat#25-0621-82, RRID: AB_469633 APC anti-mouse KLRG1 (2F1) BD PharMingen Cat#561620, RRID: AB_10523219 PE anti-mouse CD127 (A7R34) BioLegend Cat#135010, RRID: AB_1937251 FITC anti-mouse IFNg (XMG1.2) BioLegend Cat#505806, RRID: AB_315400 PE anti-mouse TNFa (MP6-XT22) Invitrogen Cat#12-7321-82, RRID: AB_466199 APC anti-mouse GZMB (GB11) Invitrogen Cat#GRB05, RRID: AB_2536539 FITC anti-mouse Ki-67 (SolA15) Invitrogen Cat#11-5698-82, RRID: AB_11151330 PE anti-mouse IRF4 (IRF4.3E4) BioLegend Cat#646403, RRID: AB_2563004 PE Streptavidin BioLegend Cat#405204 APC Streptavidin BioLegend Cat#405243 FITC Streptavidin Invitrogen Cat#11-4317-87 Chemicals, peptides, and recombinant proteins OVA257-264 peptide (SIINFEKL) Chinapeptides Cat#138831-86-4 Actinomycin D CST Cat#15021 Recombinant human IL-2 PeproTech Cat#200-02-1000 Ionomycin Biovision Cat#1566 GolgiStop BD Cat#554724, RRID: AB_2869012 Polybrene Sigma-Aldrich Cat#H9268 Critical commercial assays NEBuilder HiFi DNA Assembly Master Mix NEB Cat#E2621S Q5 High-Fidelity DNA Polymerase NEB Cat#M0491L TIANamp Genomic DNA Kit TIANGEN Cat#DP304 RNAprep Pure Cell/Bacteria Kit TIANGEN Cat#DP430 TIANScript II RT Kit TIANGEN Cat#KR107 Talent qPCR PreMix (SYBR Green) TIANGEN Cat#FP209 Transcription Factor Staining Buffer kit BD PharMingen Cat#562574, RRID: AB_2869424 (Continued on next page) e1 Cell Reports 37, 110083, December 7, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Data files for RNA-seq This paper GEO: GSE186284 Experimental models: Cell lines Phoenix-ECO ATCC Cat#CRL-3214, RRID: CVCL_H717 EL4 ATCC Cat#TIB-39, RRID: CVCL_0255 Experimental models: Organisms/strains C57BL/6 The Jackson Laboratory Cat#JAX:000664, RRID: IMSR_JAX:000664 OT-I transgenic mice (C57BL/6) The Jackson Laboratory Cat#JAX:003831, RRID: IMSR_JAX:003831 Rosa26-Cas9 knockin mice (C57BL/6) The Jackson Laboratory Cat#JAX:026430, RRID: IMSR_JAX:026430 CD45.1 (C57BL/6) The Jackson Laboratory Cat#JAX:002014, RRID: IMSR_JAX:002014 Oligonucleotides sgNon-targeting (sgControl), TTCGCACG ATTGCACCTTGG Doench et al., 2016 Addgene #73632 sgRNA targeting Pdcd1, GACACACGGC GCAATGACAG Doench et al., 2016 Addgene #73632 sgRNA targeting 1110004E09Rik, TGGCC CGCGTCTACAACGGG Doench et al., 2016 Addgene #73632 sgRNA targeting Gm10406, CTGGCTATA AGTGTCCTGTG Doench et al., 2016 Addgene #73632 sgRNA targeting Ndufa2, TCTGATCCGC GAATGCTCGG Doench et al., 2016 Addgene #73632 sgRNA targeting Atp5b, CCCACCCTAG CCACCGACAT Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1, GGATATAGCT GAGAACCTCG Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1(guide#2), ACGT ACGGTAGTGCATGGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Icos, AAATGAAAACAT CCTATGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Irf4, CAAGCAGGACTA CAATCGTG Doench et al., 2016 Addgene #73632 Next-generation sequencing (NGS) primer NGS-F1: AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTGCTTTATATATCTTGTGGAA AGGACGAAACACC This paper N/A Next-generation sequencing (NGS) primer NGS-R1: CAAGCAGAAGACGGCATACG AGATAACGTGATGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTCCGACTCG GTGCCACTTTTTCAA This paper N/A Recombinant DNA Mouse CRISPR Knockout Pooled Library (Brie) Doench et al., 2016 Addgene #73632 pCL-Eco Addgene Addgene #12371 pMSCV-sgNon-targeting-Thy1.1 (pMSCV-sgControl-Thy1.1) This paper N/A pMSCV-sgPdcd1-Thy1.1 This paper N/A pMSCV-sg1110004E09Rik-Thy1.1 This paper N/A pMSCV-sgGm10406-Thy1.1 This paper N/A pMSCV-sgNdufa2-Thy1.1 This paper N/A (Continued on next page) Cell Reports 37, 110083, December 7, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pMSCV-sgAtp5b-Thy1.1 This paper N/A pMSCV-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIcos-Thy1.1 This paper N/A pMSCV-sgIrf4-Thy1.1 This paper N/A pMSCV-sgIcos-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIrf4-sgRc3h1-Thy1.1 This paper N/A pMIG-IRES-GFP Addgene Addgene #12282 pMIG-Icos-IRES-GFP This paper N/A pMIG-IRES-Thy1.1 This paper N/A pMIG-Irf4-IRES-Thy1.1 This paper N/A Software and algorithms Prism 8 GraphPad https://www.graphpad.com FlowJo BD https://www.flowjo.com ENCoRE Tr€umbach et al., 2017 https://www.helmholtz-muenchen.de/idg/ research/genetics/bioinformatics/encore/ index.html GSEA https://www.gsea-msigdb.org/gsea/ index.jsp

    Transgenic Assay:

    Article Title: Genome-wide fitness gene identification reveals Roquin as a potent suppressor of CD8 T cell expansion and anti-tumor immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DAPI BioLegend Cat#422801 LIVE/DEAD Fixable Near-IR Dead Cell Stain Invitrogen Cat#L34976 Biotin anti-mouse Thy1.1 (OX-7) BioLegend Cat#202510, RRID: AB_2201417 PE anti-mouse Thy1.1 (OX-7) BioLegend Cat#202524, RRID: AB_1595524 APC anti-mouse CD8a (53-6.7) BioLegend Cat#100712, RRID: AB_312751 eFluor 450 anti-mouse CD8a (53-6.7) Invitrogen Cat#48-0081-82, RRID: AB_1272198 PE anti-mouse CD8a (53-6.7) BioLegend Cat#100708, RRID: AB_312747 PE-Cy7 anti-mouse CD8a (53-6.7) Invitrogen Cat#25-0081-82, RRID: AB_469584 PE anti-mouse CD45.2 (104) Invitrogen Cat#12-0454-83, RRID: AB_465679 Brilliant Violet 785 anti-mouse CD45.1 (A20) BioLegend Cat#110743, RRID: AB_2563379 PE anti-mouse ICOS (C398.4A) BioLegend Cat#313508, RRID: AB_416332 FITC anti-mouse CD25 (PC61) BioLegend Cat#102006, RRID: AB_312855 FITC anti-mouse PD-1 (29F.1A12) BioLegend Cat#135214, RRID: AB_10680238 PE anti-mouse PD-1 (29F.1A12) BioLegend Cat#135206, RRID: AB_1877231 PE-Cy7 anti-mouse TIM-3 (RMT3-23) Invitrogen Cat#25-5870-82, RRID: AB_2573483 PerCP-eFluor 710 anti-mouse LAG-3 (C9B7W) Invitrogen Cat#46-2231-82, RRID: AB_11151334 PE-Cy7 anti-mouse CD62L (MEL-14) Invitrogen Cat#25-0621-82, RRID: AB_469633 APC anti-mouse KLRG1 (2F1) BD PharMingen Cat#561620, RRID: AB_10523219 PE anti-mouse CD127 (A7R34) BioLegend Cat#135010, RRID: AB_1937251 FITC anti-mouse IFNg (XMG1.2) BioLegend Cat#505806, RRID: AB_315400 PE anti-mouse TNFa (MP6-XT22) Invitrogen Cat#12-7321-82, RRID: AB_466199 APC anti-mouse GZMB (GB11) Invitrogen Cat#GRB05, RRID: AB_2536539 FITC anti-mouse Ki-67 (SolA15) Invitrogen Cat#11-5698-82, RRID: AB_11151330 PE anti-mouse IRF4 (IRF4.3E4) BioLegend Cat#646403, RRID: AB_2563004 PE Streptavidin BioLegend Cat#405204 APC Streptavidin BioLegend Cat#405243 FITC Streptavidin Invitrogen Cat#11-4317-87 Chemicals, peptides, and recombinant proteins OVA257-264 peptide (SIINFEKL) Chinapeptides Cat#138831-86-4 Actinomycin D CST Cat#15021 Recombinant human IL-2 PeproTech Cat#200-02-1000 Ionomycin Biovision Cat#1566 GolgiStop BD Cat#554724, RRID: AB_2869012 Polybrene Sigma-Aldrich Cat#H9268 Critical commercial assays NEBuilder HiFi DNA Assembly Master Mix NEB Cat#E2621S Q5 High-Fidelity DNA Polymerase NEB Cat#M0491L TIANamp Genomic DNA Kit TIANGEN Cat#DP304 RNAprep Pure Cell/Bacteria Kit TIANGEN Cat#DP430 TIANScript II RT Kit TIANGEN Cat#KR107 Talent qPCR PreMix (SYBR Green) TIANGEN Cat#FP209 Transcription Factor Staining Buffer kit BD PharMingen Cat#562574, RRID: AB_2869424 (Continued on next page) e1 Cell Reports 37, 110083, December 7, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Data files for RNA-seq This paper GEO: GSE186284 Experimental models: Cell lines Phoenix-ECO ATCC Cat#CRL-3214, RRID: CVCL_H717 EL4 ATCC Cat#TIB-39, RRID: CVCL_0255 Experimental models: Organisms/strains C57BL/6 The Jackson Laboratory Cat#JAX:000664, RRID: IMSR_JAX:000664 OT-I transgenic mice (C57BL/6) The Jackson Laboratory Cat#JAX:003831, RRID: IMSR_JAX:003831 Rosa26-Cas9 knockin mice (C57BL/6) The Jackson Laboratory Cat#JAX:026430, RRID: IMSR_JAX:026430 CD45.1 (C57BL/6) The Jackson Laboratory Cat#JAX:002014, RRID: IMSR_JAX:002014 Oligonucleotides sgNon-targeting (sgControl), TTCGCACG ATTGCACCTTGG Doench et al., 2016 Addgene #73632 sgRNA targeting Pdcd1, GACACACGGC GCAATGACAG Doench et al., 2016 Addgene #73632 sgRNA targeting 1110004E09Rik, TGGCC CGCGTCTACAACGGG Doench et al., 2016 Addgene #73632 sgRNA targeting Gm10406, CTGGCTATA AGTGTCCTGTG Doench et al., 2016 Addgene #73632 sgRNA targeting Ndufa2, TCTGATCCGC GAATGCTCGG Doench et al., 2016 Addgene #73632 sgRNA targeting Atp5b, CCCACCCTAG CCACCGACAT Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1, GGATATAGCT GAGAACCTCG Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1(guide#2), ACGT ACGGTAGTGCATGGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Icos, AAATGAAAACAT CCTATGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Irf4, CAAGCAGGACTA CAATCGTG Doench et al., 2016 Addgene #73632 Next-generation sequencing (NGS) primer NGS-F1: AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTGCTTTATATATCTTGTGGAA AGGACGAAACACC This paper N/A Next-generation sequencing (NGS) primer NGS-R1: CAAGCAGAAGACGGCATACG AGATAACGTGATGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTCCGACTCG GTGCCACTTTTTCAA This paper N/A Recombinant DNA Mouse CRISPR Knockout Pooled Library (Brie) Doench et al., 2016 Addgene #73632 pCL-Eco Addgene Addgene #12371 pMSCV-sgNon-targeting-Thy1.1 (pMSCV-sgControl-Thy1.1) This paper N/A pMSCV-sgPdcd1-Thy1.1 This paper N/A pMSCV-sg1110004E09Rik-Thy1.1 This paper N/A pMSCV-sgGm10406-Thy1.1 This paper N/A pMSCV-sgNdufa2-Thy1.1 This paper N/A (Continued on next page) Cell Reports 37, 110083, December 7, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pMSCV-sgAtp5b-Thy1.1 This paper N/A pMSCV-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIcos-Thy1.1 This paper N/A pMSCV-sgIrf4-Thy1.1 This paper N/A pMSCV-sgIcos-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIrf4-sgRc3h1-Thy1.1 This paper N/A pMIG-IRES-GFP Addgene Addgene #12282 pMIG-Icos-IRES-GFP This paper N/A pMIG-IRES-Thy1.1 This paper N/A pMIG-Irf4-IRES-Thy1.1 This paper N/A Software and algorithms Prism 8 GraphPad https://www.graphpad.com FlowJo BD https://www.flowjo.com ENCoRE Tr€umbach et al., 2017 https://www.helmholtz-muenchen.de/idg/ research/genetics/bioinformatics/encore/ index.html GSEA https://www.gsea-msigdb.org/gsea/ index.jsp

    Knock-In:

    Article Title: Genome-wide fitness gene identification reveals Roquin as a potent suppressor of CD8 T cell expansion and anti-tumor immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DAPI BioLegend Cat#422801 LIVE/DEAD Fixable Near-IR Dead Cell Stain Invitrogen Cat#L34976 Biotin anti-mouse Thy1.1 (OX-7) BioLegend Cat#202510, RRID: AB_2201417 PE anti-mouse Thy1.1 (OX-7) BioLegend Cat#202524, RRID: AB_1595524 APC anti-mouse CD8a (53-6.7) BioLegend Cat#100712, RRID: AB_312751 eFluor 450 anti-mouse CD8a (53-6.7) Invitrogen Cat#48-0081-82, RRID: AB_1272198 PE anti-mouse CD8a (53-6.7) BioLegend Cat#100708, RRID: AB_312747 PE-Cy7 anti-mouse CD8a (53-6.7) Invitrogen Cat#25-0081-82, RRID: AB_469584 PE anti-mouse CD45.2 (104) Invitrogen Cat#12-0454-83, RRID: AB_465679 Brilliant Violet 785 anti-mouse CD45.1 (A20) BioLegend Cat#110743, RRID: AB_2563379 PE anti-mouse ICOS (C398.4A) BioLegend Cat#313508, RRID: AB_416332 FITC anti-mouse CD25 (PC61) BioLegend Cat#102006, RRID: AB_312855 FITC anti-mouse PD-1 (29F.1A12) BioLegend Cat#135214, RRID: AB_10680238 PE anti-mouse PD-1 (29F.1A12) BioLegend Cat#135206, RRID: AB_1877231 PE-Cy7 anti-mouse TIM-3 (RMT3-23) Invitrogen Cat#25-5870-82, RRID: AB_2573483 PerCP-eFluor 710 anti-mouse LAG-3 (C9B7W) Invitrogen Cat#46-2231-82, RRID: AB_11151334 PE-Cy7 anti-mouse CD62L (MEL-14) Invitrogen Cat#25-0621-82, RRID: AB_469633 APC anti-mouse KLRG1 (2F1) BD PharMingen Cat#561620, RRID: AB_10523219 PE anti-mouse CD127 (A7R34) BioLegend Cat#135010, RRID: AB_1937251 FITC anti-mouse IFNg (XMG1.2) BioLegend Cat#505806, RRID: AB_315400 PE anti-mouse TNFa (MP6-XT22) Invitrogen Cat#12-7321-82, RRID: AB_466199 APC anti-mouse GZMB (GB11) Invitrogen Cat#GRB05, RRID: AB_2536539 FITC anti-mouse Ki-67 (SolA15) Invitrogen Cat#11-5698-82, RRID: AB_11151330 PE anti-mouse IRF4 (IRF4.3E4) BioLegend Cat#646403, RRID: AB_2563004 PE Streptavidin BioLegend Cat#405204 APC Streptavidin BioLegend Cat#405243 FITC Streptavidin Invitrogen Cat#11-4317-87 Chemicals, peptides, and recombinant proteins OVA257-264 peptide (SIINFEKL) Chinapeptides Cat#138831-86-4 Actinomycin D CST Cat#15021 Recombinant human IL-2 PeproTech Cat#200-02-1000 Ionomycin Biovision Cat#1566 GolgiStop BD Cat#554724, RRID: AB_2869012 Polybrene Sigma-Aldrich Cat#H9268 Critical commercial assays NEBuilder HiFi DNA Assembly Master Mix NEB Cat#E2621S Q5 High-Fidelity DNA Polymerase NEB Cat#M0491L TIANamp Genomic DNA Kit TIANGEN Cat#DP304 RNAprep Pure Cell/Bacteria Kit TIANGEN Cat#DP430 TIANScript II RT Kit TIANGEN Cat#KR107 Talent qPCR PreMix (SYBR Green) TIANGEN Cat#FP209 Transcription Factor Staining Buffer kit BD PharMingen Cat#562574, RRID: AB_2869424 (Continued on next page) e1 Cell Reports 37, 110083, December 7, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Data files for RNA-seq This paper GEO: GSE186284 Experimental models: Cell lines Phoenix-ECO ATCC Cat#CRL-3214, RRID: CVCL_H717 EL4 ATCC Cat#TIB-39, RRID: CVCL_0255 Experimental models: Organisms/strains C57BL/6 The Jackson Laboratory Cat#JAX:000664, RRID: IMSR_JAX:000664 OT-I transgenic mice (C57BL/6) The Jackson Laboratory Cat#JAX:003831, RRID: IMSR_JAX:003831 Rosa26-Cas9 knockin mice (C57BL/6) The Jackson Laboratory Cat#JAX:026430, RRID: IMSR_JAX:026430 CD45.1 (C57BL/6) The Jackson Laboratory Cat#JAX:002014, RRID: IMSR_JAX:002014 Oligonucleotides sgNon-targeting (sgControl), TTCGCACG ATTGCACCTTGG Doench et al., 2016 Addgene #73632 sgRNA targeting Pdcd1, GACACACGGC GCAATGACAG Doench et al., 2016 Addgene #73632 sgRNA targeting 1110004E09Rik, TGGCC CGCGTCTACAACGGG Doench et al., 2016 Addgene #73632 sgRNA targeting Gm10406, CTGGCTATA AGTGTCCTGTG Doench et al., 2016 Addgene #73632 sgRNA targeting Ndufa2, TCTGATCCGC GAATGCTCGG Doench et al., 2016 Addgene #73632 sgRNA targeting Atp5b, CCCACCCTAG CCACCGACAT Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1, GGATATAGCT GAGAACCTCG Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1(guide#2), ACGT ACGGTAGTGCATGGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Icos, AAATGAAAACAT CCTATGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Irf4, CAAGCAGGACTA CAATCGTG Doench et al., 2016 Addgene #73632 Next-generation sequencing (NGS) primer NGS-F1: AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTGCTTTATATATCTTGTGGAA AGGACGAAACACC This paper N/A Next-generation sequencing (NGS) primer NGS-R1: CAAGCAGAAGACGGCATACG AGATAACGTGATGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTCCGACTCG GTGCCACTTTTTCAA This paper N/A Recombinant DNA Mouse CRISPR Knockout Pooled Library (Brie) Doench et al., 2016 Addgene #73632 pCL-Eco Addgene Addgene #12371 pMSCV-sgNon-targeting-Thy1.1 (pMSCV-sgControl-Thy1.1) This paper N/A pMSCV-sgPdcd1-Thy1.1 This paper N/A pMSCV-sg1110004E09Rik-Thy1.1 This paper N/A pMSCV-sgGm10406-Thy1.1 This paper N/A pMSCV-sgNdufa2-Thy1.1 This paper N/A (Continued on next page) Cell Reports 37, 110083, December 7, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pMSCV-sgAtp5b-Thy1.1 This paper N/A pMSCV-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIcos-Thy1.1 This paper N/A pMSCV-sgIrf4-Thy1.1 This paper N/A pMSCV-sgIcos-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIrf4-sgRc3h1-Thy1.1 This paper N/A pMIG-IRES-GFP Addgene Addgene #12282 pMIG-Icos-IRES-GFP This paper N/A pMIG-IRES-Thy1.1 This paper N/A pMIG-Irf4-IRES-Thy1.1 This paper N/A Software and algorithms Prism 8 GraphPad https://www.graphpad.com FlowJo BD https://www.flowjo.com ENCoRE Tr€umbach et al., 2017 https://www.helmholtz-muenchen.de/idg/ research/genetics/bioinformatics/encore/ index.html GSEA https://www.gsea-msigdb.org/gsea/ index.jsp

    Next-Generation Sequencing:

    Article Title: Genome-wide fitness gene identification reveals Roquin as a potent suppressor of CD8 T cell expansion and anti-tumor immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DAPI BioLegend Cat#422801 LIVE/DEAD Fixable Near-IR Dead Cell Stain Invitrogen Cat#L34976 Biotin anti-mouse Thy1.1 (OX-7) BioLegend Cat#202510, RRID: AB_2201417 PE anti-mouse Thy1.1 (OX-7) BioLegend Cat#202524, RRID: AB_1595524 APC anti-mouse CD8a (53-6.7) BioLegend Cat#100712, RRID: AB_312751 eFluor 450 anti-mouse CD8a (53-6.7) Invitrogen Cat#48-0081-82, RRID: AB_1272198 PE anti-mouse CD8a (53-6.7) BioLegend Cat#100708, RRID: AB_312747 PE-Cy7 anti-mouse CD8a (53-6.7) Invitrogen Cat#25-0081-82, RRID: AB_469584 PE anti-mouse CD45.2 (104) Invitrogen Cat#12-0454-83, RRID: AB_465679 Brilliant Violet 785 anti-mouse CD45.1 (A20) BioLegend Cat#110743, RRID: AB_2563379 PE anti-mouse ICOS (C398.4A) BioLegend Cat#313508, RRID: AB_416332 FITC anti-mouse CD25 (PC61) BioLegend Cat#102006, RRID: AB_312855 FITC anti-mouse PD-1 (29F.1A12) BioLegend Cat#135214, RRID: AB_10680238 PE anti-mouse PD-1 (29F.1A12) BioLegend Cat#135206, RRID: AB_1877231 PE-Cy7 anti-mouse TIM-3 (RMT3-23) Invitrogen Cat#25-5870-82, RRID: AB_2573483 PerCP-eFluor 710 anti-mouse LAG-3 (C9B7W) Invitrogen Cat#46-2231-82, RRID: AB_11151334 PE-Cy7 anti-mouse CD62L (MEL-14) Invitrogen Cat#25-0621-82, RRID: AB_469633 APC anti-mouse KLRG1 (2F1) BD PharMingen Cat#561620, RRID: AB_10523219 PE anti-mouse CD127 (A7R34) BioLegend Cat#135010, RRID: AB_1937251 FITC anti-mouse IFNg (XMG1.2) BioLegend Cat#505806, RRID: AB_315400 PE anti-mouse TNFa (MP6-XT22) Invitrogen Cat#12-7321-82, RRID: AB_466199 APC anti-mouse GZMB (GB11) Invitrogen Cat#GRB05, RRID: AB_2536539 FITC anti-mouse Ki-67 (SolA15) Invitrogen Cat#11-5698-82, RRID: AB_11151330 PE anti-mouse IRF4 (IRF4.3E4) BioLegend Cat#646403, RRID: AB_2563004 PE Streptavidin BioLegend Cat#405204 APC Streptavidin BioLegend Cat#405243 FITC Streptavidin Invitrogen Cat#11-4317-87 Chemicals, peptides, and recombinant proteins OVA257-264 peptide (SIINFEKL) Chinapeptides Cat#138831-86-4 Actinomycin D CST Cat#15021 Recombinant human IL-2 PeproTech Cat#200-02-1000 Ionomycin Biovision Cat#1566 GolgiStop BD Cat#554724, RRID: AB_2869012 Polybrene Sigma-Aldrich Cat#H9268 Critical commercial assays NEBuilder HiFi DNA Assembly Master Mix NEB Cat#E2621S Q5 High-Fidelity DNA Polymerase NEB Cat#M0491L TIANamp Genomic DNA Kit TIANGEN Cat#DP304 RNAprep Pure Cell/Bacteria Kit TIANGEN Cat#DP430 TIANScript II RT Kit TIANGEN Cat#KR107 Talent qPCR PreMix (SYBR Green) TIANGEN Cat#FP209 Transcription Factor Staining Buffer kit BD PharMingen Cat#562574, RRID: AB_2869424 (Continued on next page) e1 Cell Reports 37, 110083, December 7, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Data files for RNA-seq This paper GEO: GSE186284 Experimental models: Cell lines Phoenix-ECO ATCC Cat#CRL-3214, RRID: CVCL_H717 EL4 ATCC Cat#TIB-39, RRID: CVCL_0255 Experimental models: Organisms/strains C57BL/6 The Jackson Laboratory Cat#JAX:000664, RRID: IMSR_JAX:000664 OT-I transgenic mice (C57BL/6) The Jackson Laboratory Cat#JAX:003831, RRID: IMSR_JAX:003831 Rosa26-Cas9 knockin mice (C57BL/6) The Jackson Laboratory Cat#JAX:026430, RRID: IMSR_JAX:026430 CD45.1 (C57BL/6) The Jackson Laboratory Cat#JAX:002014, RRID: IMSR_JAX:002014 Oligonucleotides sgNon-targeting (sgControl), TTCGCACG ATTGCACCTTGG Doench et al., 2016 Addgene #73632 sgRNA targeting Pdcd1, GACACACGGC GCAATGACAG Doench et al., 2016 Addgene #73632 sgRNA targeting 1110004E09Rik, TGGCC CGCGTCTACAACGGG Doench et al., 2016 Addgene #73632 sgRNA targeting Gm10406, CTGGCTATA AGTGTCCTGTG Doench et al., 2016 Addgene #73632 sgRNA targeting Ndufa2, TCTGATCCGC GAATGCTCGG Doench et al., 2016 Addgene #73632 sgRNA targeting Atp5b, CCCACCCTAG CCACCGACAT Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1, GGATATAGCT GAGAACCTCG Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1(guide#2), ACGT ACGGTAGTGCATGGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Icos, AAATGAAAACAT CCTATGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Irf4, CAAGCAGGACTA CAATCGTG Doench et al., 2016 Addgene #73632 Next-generation sequencing (NGS) primer NGS-F1: AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTGCTTTATATATCTTGTGGAA AGGACGAAACACC This paper N/A Next-generation sequencing (NGS) primer NGS-R1: CAAGCAGAAGACGGCATACG AGATAACGTGATGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTCCGACTCG GTGCCACTTTTTCAA This paper N/A Recombinant DNA Mouse CRISPR Knockout Pooled Library (Brie) Doench et al., 2016 Addgene #73632 pCL-Eco Addgene Addgene #12371 pMSCV-sgNon-targeting-Thy1.1 (pMSCV-sgControl-Thy1.1) This paper N/A pMSCV-sgPdcd1-Thy1.1 This paper N/A pMSCV-sg1110004E09Rik-Thy1.1 This paper N/A pMSCV-sgGm10406-Thy1.1 This paper N/A pMSCV-sgNdufa2-Thy1.1 This paper N/A (Continued on next page) Cell Reports 37, 110083, December 7, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pMSCV-sgAtp5b-Thy1.1 This paper N/A pMSCV-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIcos-Thy1.1 This paper N/A pMSCV-sgIrf4-Thy1.1 This paper N/A pMSCV-sgIcos-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIrf4-sgRc3h1-Thy1.1 This paper N/A pMIG-IRES-GFP Addgene Addgene #12282 pMIG-Icos-IRES-GFP This paper N/A pMIG-IRES-Thy1.1 This paper N/A pMIG-Irf4-IRES-Thy1.1 This paper N/A Software and algorithms Prism 8 GraphPad https://www.graphpad.com FlowJo BD https://www.flowjo.com ENCoRE Tr€umbach et al., 2017 https://www.helmholtz-muenchen.de/idg/ research/genetics/bioinformatics/encore/ index.html GSEA https://www.gsea-msigdb.org/gsea/ index.jsp

    Recombinant:

    Article Title: Genome-wide fitness gene identification reveals Roquin as a potent suppressor of CD8 T cell expansion and anti-tumor immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DAPI BioLegend Cat#422801 LIVE/DEAD Fixable Near-IR Dead Cell Stain Invitrogen Cat#L34976 Biotin anti-mouse Thy1.1 (OX-7) BioLegend Cat#202510, RRID: AB_2201417 PE anti-mouse Thy1.1 (OX-7) BioLegend Cat#202524, RRID: AB_1595524 APC anti-mouse CD8a (53-6.7) BioLegend Cat#100712, RRID: AB_312751 eFluor 450 anti-mouse CD8a (53-6.7) Invitrogen Cat#48-0081-82, RRID: AB_1272198 PE anti-mouse CD8a (53-6.7) BioLegend Cat#100708, RRID: AB_312747 PE-Cy7 anti-mouse CD8a (53-6.7) Invitrogen Cat#25-0081-82, RRID: AB_469584 PE anti-mouse CD45.2 (104) Invitrogen Cat#12-0454-83, RRID: AB_465679 Brilliant Violet 785 anti-mouse CD45.1 (A20) BioLegend Cat#110743, RRID: AB_2563379 PE anti-mouse ICOS (C398.4A) BioLegend Cat#313508, RRID: AB_416332 FITC anti-mouse CD25 (PC61) BioLegend Cat#102006, RRID: AB_312855 FITC anti-mouse PD-1 (29F.1A12) BioLegend Cat#135214, RRID: AB_10680238 PE anti-mouse PD-1 (29F.1A12) BioLegend Cat#135206, RRID: AB_1877231 PE-Cy7 anti-mouse TIM-3 (RMT3-23) Invitrogen Cat#25-5870-82, RRID: AB_2573483 PerCP-eFluor 710 anti-mouse LAG-3 (C9B7W) Invitrogen Cat#46-2231-82, RRID: AB_11151334 PE-Cy7 anti-mouse CD62L (MEL-14) Invitrogen Cat#25-0621-82, RRID: AB_469633 APC anti-mouse KLRG1 (2F1) BD PharMingen Cat#561620, RRID: AB_10523219 PE anti-mouse CD127 (A7R34) BioLegend Cat#135010, RRID: AB_1937251 FITC anti-mouse IFNg (XMG1.2) BioLegend Cat#505806, RRID: AB_315400 PE anti-mouse TNFa (MP6-XT22) Invitrogen Cat#12-7321-82, RRID: AB_466199 APC anti-mouse GZMB (GB11) Invitrogen Cat#GRB05, RRID: AB_2536539 FITC anti-mouse Ki-67 (SolA15) Invitrogen Cat#11-5698-82, RRID: AB_11151330 PE anti-mouse IRF4 (IRF4.3E4) BioLegend Cat#646403, RRID: AB_2563004 PE Streptavidin BioLegend Cat#405204 APC Streptavidin BioLegend Cat#405243 FITC Streptavidin Invitrogen Cat#11-4317-87 Chemicals, peptides, and recombinant proteins OVA257-264 peptide (SIINFEKL) Chinapeptides Cat#138831-86-4 Actinomycin D CST Cat#15021 Recombinant human IL-2 PeproTech Cat#200-02-1000 Ionomycin Biovision Cat#1566 GolgiStop BD Cat#554724, RRID: AB_2869012 Polybrene Sigma-Aldrich Cat#H9268 Critical commercial assays NEBuilder HiFi DNA Assembly Master Mix NEB Cat#E2621S Q5 High-Fidelity DNA Polymerase NEB Cat#M0491L TIANamp Genomic DNA Kit TIANGEN Cat#DP304 RNAprep Pure Cell/Bacteria Kit TIANGEN Cat#DP430 TIANScript II RT Kit TIANGEN Cat#KR107 Talent qPCR PreMix (SYBR Green) TIANGEN Cat#FP209 Transcription Factor Staining Buffer kit BD PharMingen Cat#562574, RRID: AB_2869424 (Continued on next page) e1 Cell Reports 37, 110083, December 7, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Data files for RNA-seq This paper GEO: GSE186284 Experimental models: Cell lines Phoenix-ECO ATCC Cat#CRL-3214, RRID: CVCL_H717 EL4 ATCC Cat#TIB-39, RRID: CVCL_0255 Experimental models: Organisms/strains C57BL/6 The Jackson Laboratory Cat#JAX:000664, RRID: IMSR_JAX:000664 OT-I transgenic mice (C57BL/6) The Jackson Laboratory Cat#JAX:003831, RRID: IMSR_JAX:003831 Rosa26-Cas9 knockin mice (C57BL/6) The Jackson Laboratory Cat#JAX:026430, RRID: IMSR_JAX:026430 CD45.1 (C57BL/6) The Jackson Laboratory Cat#JAX:002014, RRID: IMSR_JAX:002014 Oligonucleotides sgNon-targeting (sgControl), TTCGCACG ATTGCACCTTGG Doench et al., 2016 Addgene #73632 sgRNA targeting Pdcd1, GACACACGGC GCAATGACAG Doench et al., 2016 Addgene #73632 sgRNA targeting 1110004E09Rik, TGGCC CGCGTCTACAACGGG Doench et al., 2016 Addgene #73632 sgRNA targeting Gm10406, CTGGCTATA AGTGTCCTGTG Doench et al., 2016 Addgene #73632 sgRNA targeting Ndufa2, TCTGATCCGC GAATGCTCGG Doench et al., 2016 Addgene #73632 sgRNA targeting Atp5b, CCCACCCTAG CCACCGACAT Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1, GGATATAGCT GAGAACCTCG Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1(guide#2), ACGT ACGGTAGTGCATGGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Icos, AAATGAAAACAT CCTATGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Irf4, CAAGCAGGACTA CAATCGTG Doench et al., 2016 Addgene #73632 Next-generation sequencing (NGS) primer NGS-F1: AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTGCTTTATATATCTTGTGGAA AGGACGAAACACC This paper N/A Next-generation sequencing (NGS) primer NGS-R1: CAAGCAGAAGACGGCATACG AGATAACGTGATGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTCCGACTCG GTGCCACTTTTTCAA This paper N/A Recombinant DNA Mouse CRISPR Knockout Pooled Library (Brie) Doench et al., 2016 Addgene #73632 pCL-Eco Addgene Addgene #12371 pMSCV-sgNon-targeting-Thy1.1 (pMSCV-sgControl-Thy1.1) This paper N/A pMSCV-sgPdcd1-Thy1.1 This paper N/A pMSCV-sg1110004E09Rik-Thy1.1 This paper N/A pMSCV-sgGm10406-Thy1.1 This paper N/A pMSCV-sgNdufa2-Thy1.1 This paper N/A (Continued on next page) Cell Reports 37, 110083, December 7, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pMSCV-sgAtp5b-Thy1.1 This paper N/A pMSCV-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIcos-Thy1.1 This paper N/A pMSCV-sgIrf4-Thy1.1 This paper N/A pMSCV-sgIcos-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIrf4-sgRc3h1-Thy1.1 This paper N/A pMIG-IRES-GFP Addgene Addgene #12282 pMIG-Icos-IRES-GFP This paper N/A pMIG-IRES-Thy1.1 This paper N/A pMIG-Irf4-IRES-Thy1.1 This paper N/A Software and algorithms Prism 8 GraphPad https://www.graphpad.com FlowJo BD https://www.flowjo.com ENCoRE Tr€umbach et al., 2017 https://www.helmholtz-muenchen.de/idg/ research/genetics/bioinformatics/encore/ index.html GSEA https://www.gsea-msigdb.org/gsea/ index.jsp

    CRISPR:

    Article Title: Genome-wide fitness gene identification reveals Roquin as a potent suppressor of CD8 T cell expansion and anti-tumor immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DAPI BioLegend Cat#422801 LIVE/DEAD Fixable Near-IR Dead Cell Stain Invitrogen Cat#L34976 Biotin anti-mouse Thy1.1 (OX-7) BioLegend Cat#202510, RRID: AB_2201417 PE anti-mouse Thy1.1 (OX-7) BioLegend Cat#202524, RRID: AB_1595524 APC anti-mouse CD8a (53-6.7) BioLegend Cat#100712, RRID: AB_312751 eFluor 450 anti-mouse CD8a (53-6.7) Invitrogen Cat#48-0081-82, RRID: AB_1272198 PE anti-mouse CD8a (53-6.7) BioLegend Cat#100708, RRID: AB_312747 PE-Cy7 anti-mouse CD8a (53-6.7) Invitrogen Cat#25-0081-82, RRID: AB_469584 PE anti-mouse CD45.2 (104) Invitrogen Cat#12-0454-83, RRID: AB_465679 Brilliant Violet 785 anti-mouse CD45.1 (A20) BioLegend Cat#110743, RRID: AB_2563379 PE anti-mouse ICOS (C398.4A) BioLegend Cat#313508, RRID: AB_416332 FITC anti-mouse CD25 (PC61) BioLegend Cat#102006, RRID: AB_312855 FITC anti-mouse PD-1 (29F.1A12) BioLegend Cat#135214, RRID: AB_10680238 PE anti-mouse PD-1 (29F.1A12) BioLegend Cat#135206, RRID: AB_1877231 PE-Cy7 anti-mouse TIM-3 (RMT3-23) Invitrogen Cat#25-5870-82, RRID: AB_2573483 PerCP-eFluor 710 anti-mouse LAG-3 (C9B7W) Invitrogen Cat#46-2231-82, RRID: AB_11151334 PE-Cy7 anti-mouse CD62L (MEL-14) Invitrogen Cat#25-0621-82, RRID: AB_469633 APC anti-mouse KLRG1 (2F1) BD PharMingen Cat#561620, RRID: AB_10523219 PE anti-mouse CD127 (A7R34) BioLegend Cat#135010, RRID: AB_1937251 FITC anti-mouse IFNg (XMG1.2) BioLegend Cat#505806, RRID: AB_315400 PE anti-mouse TNFa (MP6-XT22) Invitrogen Cat#12-7321-82, RRID: AB_466199 APC anti-mouse GZMB (GB11) Invitrogen Cat#GRB05, RRID: AB_2536539 FITC anti-mouse Ki-67 (SolA15) Invitrogen Cat#11-5698-82, RRID: AB_11151330 PE anti-mouse IRF4 (IRF4.3E4) BioLegend Cat#646403, RRID: AB_2563004 PE Streptavidin BioLegend Cat#405204 APC Streptavidin BioLegend Cat#405243 FITC Streptavidin Invitrogen Cat#11-4317-87 Chemicals, peptides, and recombinant proteins OVA257-264 peptide (SIINFEKL) Chinapeptides Cat#138831-86-4 Actinomycin D CST Cat#15021 Recombinant human IL-2 PeproTech Cat#200-02-1000 Ionomycin Biovision Cat#1566 GolgiStop BD Cat#554724, RRID: AB_2869012 Polybrene Sigma-Aldrich Cat#H9268 Critical commercial assays NEBuilder HiFi DNA Assembly Master Mix NEB Cat#E2621S Q5 High-Fidelity DNA Polymerase NEB Cat#M0491L TIANamp Genomic DNA Kit TIANGEN Cat#DP304 RNAprep Pure Cell/Bacteria Kit TIANGEN Cat#DP430 TIANScript II RT Kit TIANGEN Cat#KR107 Talent qPCR PreMix (SYBR Green) TIANGEN Cat#FP209 Transcription Factor Staining Buffer kit BD PharMingen Cat#562574, RRID: AB_2869424 (Continued on next page) e1 Cell Reports 37, 110083, December 7, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Data files for RNA-seq This paper GEO: GSE186284 Experimental models: Cell lines Phoenix-ECO ATCC Cat#CRL-3214, RRID: CVCL_H717 EL4 ATCC Cat#TIB-39, RRID: CVCL_0255 Experimental models: Organisms/strains C57BL/6 The Jackson Laboratory Cat#JAX:000664, RRID: IMSR_JAX:000664 OT-I transgenic mice (C57BL/6) The Jackson Laboratory Cat#JAX:003831, RRID: IMSR_JAX:003831 Rosa26-Cas9 knockin mice (C57BL/6) The Jackson Laboratory Cat#JAX:026430, RRID: IMSR_JAX:026430 CD45.1 (C57BL/6) The Jackson Laboratory Cat#JAX:002014, RRID: IMSR_JAX:002014 Oligonucleotides sgNon-targeting (sgControl), TTCGCACG ATTGCACCTTGG Doench et al., 2016 Addgene #73632 sgRNA targeting Pdcd1, GACACACGGC GCAATGACAG Doench et al., 2016 Addgene #73632 sgRNA targeting 1110004E09Rik, TGGCC CGCGTCTACAACGGG Doench et al., 2016 Addgene #73632 sgRNA targeting Gm10406, CTGGCTATA AGTGTCCTGTG Doench et al., 2016 Addgene #73632 sgRNA targeting Ndufa2, TCTGATCCGC GAATGCTCGG Doench et al., 2016 Addgene #73632 sgRNA targeting Atp5b, CCCACCCTAG CCACCGACAT Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1, GGATATAGCT GAGAACCTCG Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1(guide#2), ACGT ACGGTAGTGCATGGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Icos, AAATGAAAACAT CCTATGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Irf4, CAAGCAGGACTA CAATCGTG Doench et al., 2016 Addgene #73632 Next-generation sequencing (NGS) primer NGS-F1: AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTGCTTTATATATCTTGTGGAA AGGACGAAACACC This paper N/A Next-generation sequencing (NGS) primer NGS-R1: CAAGCAGAAGACGGCATACG AGATAACGTGATGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTCCGACTCG GTGCCACTTTTTCAA This paper N/A Recombinant DNA Mouse CRISPR Knockout Pooled Library (Brie) Doench et al., 2016 Addgene #73632 pCL-Eco Addgene Addgene #12371 pMSCV-sgNon-targeting-Thy1.1 (pMSCV-sgControl-Thy1.1) This paper N/A pMSCV-sgPdcd1-Thy1.1 This paper N/A pMSCV-sg1110004E09Rik-Thy1.1 This paper N/A pMSCV-sgGm10406-Thy1.1 This paper N/A pMSCV-sgNdufa2-Thy1.1 This paper N/A (Continued on next page) Cell Reports 37, 110083, December 7, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pMSCV-sgAtp5b-Thy1.1 This paper N/A pMSCV-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIcos-Thy1.1 This paper N/A pMSCV-sgIrf4-Thy1.1 This paper N/A pMSCV-sgIcos-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIrf4-sgRc3h1-Thy1.1 This paper N/A pMIG-IRES-GFP Addgene Addgene #12282 pMIG-Icos-IRES-GFP This paper N/A pMIG-IRES-Thy1.1 This paper N/A pMIG-Irf4-IRES-Thy1.1 This paper N/A Software and algorithms Prism 8 GraphPad https://www.graphpad.com FlowJo BD https://www.flowjo.com ENCoRE Tr€umbach et al., 2017 https://www.helmholtz-muenchen.de/idg/ research/genetics/bioinformatics/encore/ index.html GSEA https://www.gsea-msigdb.org/gsea/ index.jsp

    Knock-Out:

    Article Title: Genome-wide fitness gene identification reveals Roquin as a potent suppressor of CD8 T cell expansion and anti-tumor immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DAPI BioLegend Cat#422801 LIVE/DEAD Fixable Near-IR Dead Cell Stain Invitrogen Cat#L34976 Biotin anti-mouse Thy1.1 (OX-7) BioLegend Cat#202510, RRID: AB_2201417 PE anti-mouse Thy1.1 (OX-7) BioLegend Cat#202524, RRID: AB_1595524 APC anti-mouse CD8a (53-6.7) BioLegend Cat#100712, RRID: AB_312751 eFluor 450 anti-mouse CD8a (53-6.7) Invitrogen Cat#48-0081-82, RRID: AB_1272198 PE anti-mouse CD8a (53-6.7) BioLegend Cat#100708, RRID: AB_312747 PE-Cy7 anti-mouse CD8a (53-6.7) Invitrogen Cat#25-0081-82, RRID: AB_469584 PE anti-mouse CD45.2 (104) Invitrogen Cat#12-0454-83, RRID: AB_465679 Brilliant Violet 785 anti-mouse CD45.1 (A20) BioLegend Cat#110743, RRID: AB_2563379 PE anti-mouse ICOS (C398.4A) BioLegend Cat#313508, RRID: AB_416332 FITC anti-mouse CD25 (PC61) BioLegend Cat#102006, RRID: AB_312855 FITC anti-mouse PD-1 (29F.1A12) BioLegend Cat#135214, RRID: AB_10680238 PE anti-mouse PD-1 (29F.1A12) BioLegend Cat#135206, RRID: AB_1877231 PE-Cy7 anti-mouse TIM-3 (RMT3-23) Invitrogen Cat#25-5870-82, RRID: AB_2573483 PerCP-eFluor 710 anti-mouse LAG-3 (C9B7W) Invitrogen Cat#46-2231-82, RRID: AB_11151334 PE-Cy7 anti-mouse CD62L (MEL-14) Invitrogen Cat#25-0621-82, RRID: AB_469633 APC anti-mouse KLRG1 (2F1) BD PharMingen Cat#561620, RRID: AB_10523219 PE anti-mouse CD127 (A7R34) BioLegend Cat#135010, RRID: AB_1937251 FITC anti-mouse IFNg (XMG1.2) BioLegend Cat#505806, RRID: AB_315400 PE anti-mouse TNFa (MP6-XT22) Invitrogen Cat#12-7321-82, RRID: AB_466199 APC anti-mouse GZMB (GB11) Invitrogen Cat#GRB05, RRID: AB_2536539 FITC anti-mouse Ki-67 (SolA15) Invitrogen Cat#11-5698-82, RRID: AB_11151330 PE anti-mouse IRF4 (IRF4.3E4) BioLegend Cat#646403, RRID: AB_2563004 PE Streptavidin BioLegend Cat#405204 APC Streptavidin BioLegend Cat#405243 FITC Streptavidin Invitrogen Cat#11-4317-87 Chemicals, peptides, and recombinant proteins OVA257-264 peptide (SIINFEKL) Chinapeptides Cat#138831-86-4 Actinomycin D CST Cat#15021 Recombinant human IL-2 PeproTech Cat#200-02-1000 Ionomycin Biovision Cat#1566 GolgiStop BD Cat#554724, RRID: AB_2869012 Polybrene Sigma-Aldrich Cat#H9268 Critical commercial assays NEBuilder HiFi DNA Assembly Master Mix NEB Cat#E2621S Q5 High-Fidelity DNA Polymerase NEB Cat#M0491L TIANamp Genomic DNA Kit TIANGEN Cat#DP304 RNAprep Pure Cell/Bacteria Kit TIANGEN Cat#DP430 TIANScript II RT Kit TIANGEN Cat#KR107 Talent qPCR PreMix (SYBR Green) TIANGEN Cat#FP209 Transcription Factor Staining Buffer kit BD PharMingen Cat#562574, RRID: AB_2869424 (Continued on next page) e1 Cell Reports 37, 110083, December 7, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Data files for RNA-seq This paper GEO: GSE186284 Experimental models: Cell lines Phoenix-ECO ATCC Cat#CRL-3214, RRID: CVCL_H717 EL4 ATCC Cat#TIB-39, RRID: CVCL_0255 Experimental models: Organisms/strains C57BL/6 The Jackson Laboratory Cat#JAX:000664, RRID: IMSR_JAX:000664 OT-I transgenic mice (C57BL/6) The Jackson Laboratory Cat#JAX:003831, RRID: IMSR_JAX:003831 Rosa26-Cas9 knockin mice (C57BL/6) The Jackson Laboratory Cat#JAX:026430, RRID: IMSR_JAX:026430 CD45.1 (C57BL/6) The Jackson Laboratory Cat#JAX:002014, RRID: IMSR_JAX:002014 Oligonucleotides sgNon-targeting (sgControl), TTCGCACG ATTGCACCTTGG Doench et al., 2016 Addgene #73632 sgRNA targeting Pdcd1, GACACACGGC GCAATGACAG Doench et al., 2016 Addgene #73632 sgRNA targeting 1110004E09Rik, TGGCC CGCGTCTACAACGGG Doench et al., 2016 Addgene #73632 sgRNA targeting Gm10406, CTGGCTATA AGTGTCCTGTG Doench et al., 2016 Addgene #73632 sgRNA targeting Ndufa2, TCTGATCCGC GAATGCTCGG Doench et al., 2016 Addgene #73632 sgRNA targeting Atp5b, CCCACCCTAG CCACCGACAT Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1, GGATATAGCT GAGAACCTCG Doench et al., 2016 Addgene #73632 sgRNA targeting Rc3h1(guide#2), ACGT ACGGTAGTGCATGGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Icos, AAATGAAAACAT CCTATGAT Doench et al., 2016 Addgene #73632 sgRNA targeting Irf4, CAAGCAGGACTA CAATCGTG Doench et al., 2016 Addgene #73632 Next-generation sequencing (NGS) primer NGS-F1: AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTC TTCCGATCTGCTTTATATATCTTGTGGAA AGGACGAAACACC This paper N/A Next-generation sequencing (NGS) primer NGS-R1: CAAGCAGAAGACGGCATACG AGATAACGTGATGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTCCGACTCG GTGCCACTTTTTCAA This paper N/A Recombinant DNA Mouse CRISPR Knockout Pooled Library (Brie) Doench et al., 2016 Addgene #73632 pCL-Eco Addgene Addgene #12371 pMSCV-sgNon-targeting-Thy1.1 (pMSCV-sgControl-Thy1.1) This paper N/A pMSCV-sgPdcd1-Thy1.1 This paper N/A pMSCV-sg1110004E09Rik-Thy1.1 This paper N/A pMSCV-sgGm10406-Thy1.1 This paper N/A pMSCV-sgNdufa2-Thy1.1 This paper N/A (Continued on next page) Cell Reports 37, 110083, December 7, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pMSCV-sgAtp5b-Thy1.1 This paper N/A pMSCV-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIcos-Thy1.1 This paper N/A pMSCV-sgIrf4-Thy1.1 This paper N/A pMSCV-sgIcos-sgRc3h1-Thy1.1 This paper N/A pMSCV-sgIrf4-sgRc3h1-Thy1.1 This paper N/A pMIG-IRES-GFP Addgene Addgene #12282 pMIG-Icos-IRES-GFP This paper N/A pMIG-IRES-Thy1.1 This paper N/A pMIG-Irf4-IRES-Thy1.1 This paper N/A Software and algorithms Prism 8 GraphPad https://www.graphpad.com FlowJo BD https://www.flowjo.com ENCoRE Tr€umbach et al., 2017 https://www.helmholtz-muenchen.de/idg/ research/genetics/bioinformatics/encore/ index.html GSEA https://www.gsea-msigdb.org/gsea/ index.jsp



    Similar Products

    90
    GenScript corporation lentiviral plasmid vectors containing sgrna targeting the pdcd1 exon 2 locus
    Lentiviral Plasmid Vectors Containing Sgrna Targeting The Pdcd1 Exon 2 Locus, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+targeting+pdcd1/codon+optimized+ccr1+and+ccr5/pmc09578978-43-4-15
    Average 90 stars, based on 1 article reviews
    lentiviral plasmid vectors containing sgrna targeting the pdcd1 exon 2 locus - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc pdcd1 -targeting sgrna
    a – c , Naive wild-type mice were infected with LCMV-Cl13 and T PEX <t>-cell-enriched</t> <t>(PD-1</t> + TIM-3 lo ) CD8 + T cells were sorted and subjected to scRNA-seq at 30 dpi. The resulting data were combined with publicly available scRNA-seq datasets from mouse exhausted CD8 + T cells , and analysed. a , Uniform manifold approximation and projection (UMAP) plot of 15,743 single exhausted T cells coloured according to cluster classification. b , Normalized gene expression of Tcf7 , Sell , Gzmb and Cx3cr1 projected onto the UMAP. c , Heat map showing the expression of all identified cluster signature transcripts. d , Congenically marked naive P14 cells were transferred into recipient mice, which were subsequently infected with LCMV-Docile and analysed at 21 dpi. Flow cytometry plots show the expression of PD-1, Ly108 and CD62L in splenic P14 T cells. e , UMAP plot showing two predicted developmental trajectories generated using Slingshot analysis. Cells are colour-coded on the basis of pseudotime prediction. f – k , Congenically marked naive P14 T cells were transferred into primary recipient (R1) mice, which were then infected with LCMV-Cl13. The indicated subsets of P14 T cells were sorted at 28 dpi and 3 × 10 3 –15 × 10 3 cells were re-transferred to infection-matched secondary recipient (R2) mice. Splenic P14 T cells of R2 mice were analysed at day 21 after re-transfer. f , Schematic of the experimental set-up. g , h , Flow cytometry plots ( g ) and cell numbers ( h ) of recovered progenies at day 21 after re-transfer (gated on CD4 − CD19 − cells). i – k , Flow cytometry plots ( i ), numbers ( j ) and average percentages ( k ) of recovered CD62L + T PEX , CD62L − T PEX and T EX cells per spleen in R2 mice. Cells were gated on P14 cells (day 21 after re-transfer). Dots in graphs represent individual mice ( h , j ); horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data are representative of at least two independent experiments. P values are from Mann–Whitney tests ( h , j ); P > 0.05, not significant (NS).
    Pdcd1 Targeting Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+targeting+pdcd1/pdcd1++targeting+sgrna/pmc09452299-172-9-12
    Average 90 stars, based on 1 article reviews
    pdcd1 -targeting sgrna - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Addgene inc sgrna targeting pdcd1
    a – c , Naive wild-type mice were infected with LCMV-Cl13 and T PEX <t>-cell-enriched</t> <t>(PD-1</t> + TIM-3 lo ) CD8 + T cells were sorted and subjected to scRNA-seq at 30 dpi. The resulting data were combined with publicly available scRNA-seq datasets from mouse exhausted CD8 + T cells , and analysed. a , Uniform manifold approximation and projection (UMAP) plot of 15,743 single exhausted T cells coloured according to cluster classification. b , Normalized gene expression of Tcf7 , Sell , Gzmb and Cx3cr1 projected onto the UMAP. c , Heat map showing the expression of all identified cluster signature transcripts. d , Congenically marked naive P14 cells were transferred into recipient mice, which were subsequently infected with LCMV-Docile and analysed at 21 dpi. Flow cytometry plots show the expression of PD-1, Ly108 and CD62L in splenic P14 T cells. e , UMAP plot showing two predicted developmental trajectories generated using Slingshot analysis. Cells are colour-coded on the basis of pseudotime prediction. f – k , Congenically marked naive P14 T cells were transferred into primary recipient (R1) mice, which were then infected with LCMV-Cl13. The indicated subsets of P14 T cells were sorted at 28 dpi and 3 × 10 3 –15 × 10 3 cells were re-transferred to infection-matched secondary recipient (R2) mice. Splenic P14 T cells of R2 mice were analysed at day 21 after re-transfer. f , Schematic of the experimental set-up. g , h , Flow cytometry plots ( g ) and cell numbers ( h ) of recovered progenies at day 21 after re-transfer (gated on CD4 − CD19 − cells). i – k , Flow cytometry plots ( i ), numbers ( j ) and average percentages ( k ) of recovered CD62L + T PEX , CD62L − T PEX and T EX cells per spleen in R2 mice. Cells were gated on P14 cells (day 21 after re-transfer). Dots in graphs represent individual mice ( h , j ); horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data are representative of at least two independent experiments. P values are from Mann–Whitney tests ( h , j ); P > 0.05, not significant (NS).
    Sgrna Targeting Pdcd1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+targeting+pdcd1/sgrna+targeting+pdcd1/pm34879274-249-86-87
    Average 90 stars, based on 1 article reviews
    sgrna targeting pdcd1 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc sgrnas targeting pdcd1 (59-gacacacggcgcaaugacag-39)
    a – c , Naive wild-type mice were infected with LCMV-Cl13 and T PEX <t>-cell-enriched</t> <t>(PD-1</t> + TIM-3 lo ) CD8 + T cells were sorted and subjected to scRNA-seq at 30 dpi. The resulting data were combined with publicly available scRNA-seq datasets from mouse exhausted CD8 + T cells , and analysed. a , Uniform manifold approximation and projection (UMAP) plot of 15,743 single exhausted T cells coloured according to cluster classification. b , Normalized gene expression of Tcf7 , Sell , Gzmb and Cx3cr1 projected onto the UMAP. c , Heat map showing the expression of all identified cluster signature transcripts. d , Congenically marked naive P14 cells were transferred into recipient mice, which were subsequently infected with LCMV-Docile and analysed at 21 dpi. Flow cytometry plots show the expression of PD-1, Ly108 and CD62L in splenic P14 T cells. e , UMAP plot showing two predicted developmental trajectories generated using Slingshot analysis. Cells are colour-coded on the basis of pseudotime prediction. f – k , Congenically marked naive P14 T cells were transferred into primary recipient (R1) mice, which were then infected with LCMV-Cl13. The indicated subsets of P14 T cells were sorted at 28 dpi and 3 × 10 3 –15 × 10 3 cells were re-transferred to infection-matched secondary recipient (R2) mice. Splenic P14 T cells of R2 mice were analysed at day 21 after re-transfer. f , Schematic of the experimental set-up. g , h , Flow cytometry plots ( g ) and cell numbers ( h ) of recovered progenies at day 21 after re-transfer (gated on CD4 − CD19 − cells). i – k , Flow cytometry plots ( i ), numbers ( j ) and average percentages ( k ) of recovered CD62L + T PEX , CD62L − T PEX and T EX cells per spleen in R2 mice. Cells were gated on P14 cells (day 21 after re-transfer). Dots in graphs represent individual mice ( h , j ); horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data are representative of at least two independent experiments. P values are from Mann–Whitney tests ( h , j ); P > 0.05, not significant (NS).
    Sgrnas Targeting Pdcd1 (59 Gacacacggcgcaaugacag 39), supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna+targeting+pdcd1/pdcd1++targeting+sgrna/pm32152070-70-15-29
    Average 90 stars, based on 1 article reviews
    sgrnas targeting pdcd1 (59-gacacacggcgcaaugacag-39) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    a – c , Naive wild-type mice were infected with LCMV-Cl13 and T PEX -cell-enriched (PD-1 + TIM-3 lo ) CD8 + T cells were sorted and subjected to scRNA-seq at 30 dpi. The resulting data were combined with publicly available scRNA-seq datasets from mouse exhausted CD8 + T cells , and analysed. a , Uniform manifold approximation and projection (UMAP) plot of 15,743 single exhausted T cells coloured according to cluster classification. b , Normalized gene expression of Tcf7 , Sell , Gzmb and Cx3cr1 projected onto the UMAP. c , Heat map showing the expression of all identified cluster signature transcripts. d , Congenically marked naive P14 cells were transferred into recipient mice, which were subsequently infected with LCMV-Docile and analysed at 21 dpi. Flow cytometry plots show the expression of PD-1, Ly108 and CD62L in splenic P14 T cells. e , UMAP plot showing two predicted developmental trajectories generated using Slingshot analysis. Cells are colour-coded on the basis of pseudotime prediction. f – k , Congenically marked naive P14 T cells were transferred into primary recipient (R1) mice, which were then infected with LCMV-Cl13. The indicated subsets of P14 T cells were sorted at 28 dpi and 3 × 10 3 –15 × 10 3 cells were re-transferred to infection-matched secondary recipient (R2) mice. Splenic P14 T cells of R2 mice were analysed at day 21 after re-transfer. f , Schematic of the experimental set-up. g , h , Flow cytometry plots ( g ) and cell numbers ( h ) of recovered progenies at day 21 after re-transfer (gated on CD4 − CD19 − cells). i – k , Flow cytometry plots ( i ), numbers ( j ) and average percentages ( k ) of recovered CD62L + T PEX , CD62L − T PEX and T EX cells per spleen in R2 mice. Cells were gated on P14 cells (day 21 after re-transfer). Dots in graphs represent individual mice ( h , j ); horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data are representative of at least two independent experiments. P values are from Mann–Whitney tests ( h , j ); P > 0.05, not significant (NS).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: a – c , Naive wild-type mice were infected with LCMV-Cl13 and T PEX -cell-enriched (PD-1 + TIM-3 lo ) CD8 + T cells were sorted and subjected to scRNA-seq at 30 dpi. The resulting data were combined with publicly available scRNA-seq datasets from mouse exhausted CD8 + T cells , and analysed. a , Uniform manifold approximation and projection (UMAP) plot of 15,743 single exhausted T cells coloured according to cluster classification. b , Normalized gene expression of Tcf7 , Sell , Gzmb and Cx3cr1 projected onto the UMAP. c , Heat map showing the expression of all identified cluster signature transcripts. d , Congenically marked naive P14 cells were transferred into recipient mice, which were subsequently infected with LCMV-Docile and analysed at 21 dpi. Flow cytometry plots show the expression of PD-1, Ly108 and CD62L in splenic P14 T cells. e , UMAP plot showing two predicted developmental trajectories generated using Slingshot analysis. Cells are colour-coded on the basis of pseudotime prediction. f – k , Congenically marked naive P14 T cells were transferred into primary recipient (R1) mice, which were then infected with LCMV-Cl13. The indicated subsets of P14 T cells were sorted at 28 dpi and 3 × 10 3 –15 × 10 3 cells were re-transferred to infection-matched secondary recipient (R2) mice. Splenic P14 T cells of R2 mice were analysed at day 21 after re-transfer. f , Schematic of the experimental set-up. g , h , Flow cytometry plots ( g ) and cell numbers ( h ) of recovered progenies at day 21 after re-transfer (gated on CD4 − CD19 − cells). i – k , Flow cytometry plots ( i ), numbers ( j ) and average percentages ( k ) of recovered CD62L + T PEX , CD62L − T PEX and T EX cells per spleen in R2 mice. Cells were gated on P14 cells (day 21 after re-transfer). Dots in graphs represent individual mice ( h , j ); horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data are representative of at least two independent experiments. P values are from Mann–Whitney tests ( h , j ); P > 0.05, not significant (NS).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: Infection, Expressing, Flow Cytometry, Generated, MANN-WHITNEY

    ( a , b ) CD4 + T cell-depleted naive mice were infected with LCMV-Cl13, treated with or without anti-PD-L1, and exhausted PD-1 + TIM-3 lo T cells were sorted at >day 30 post-infection as described . ( a ) Schematic of the experimental set-up. ( b ) Flow cytometry plots showing the sorting strategy. ( c–j ) Naive congenically marked (CD45.1 + ) Id3 -GFP P14 cells were transferred to naive recipients (Ly.5.2), which were then infected with LCMV-Docile. Splenic P14 T cells were analysed at the indicated time points after infection. ( c ) Schematic of the experimental set-up. ( d ) Flow cytometry plots showing the expression of Id3 -GFP, TCF1 and CD62L among splenic P14 T cells at 7 and 21 dpi. ( e ) Quantification showing absolute numbers of splenic CD62L + T PEX , CD62L − T PEX and total P14 cells (left) and frequencies of CD62L + cells among T PEX cells (right) at the indicated time points after infection ( f ) Flow cytometry plots showing the expression of Ly108 and CD62L and quantification of CD62L + T PEX cells among P14 T cells in the spleen, lymph nodes, blood, bone marrow and liver at day 31 post LCMV-Docile infection. ( g–j ) Histograms ( g , h ) and quantification ( i , j ) of expression of molecules as indicated in P14 T cell subsets and naive CD8 + T cells. ( k–p ) Congenically marked naive Nur77 -GFP reporter P14 T cells were transferred into naive ( k–m ) or CD4-T-cell-depleted ( n–p ) recipient mice, which were subsequently infected with LCMV-Cl13. Nur77 -GFP expression was analysed at indicated time points post-infection. ( k , n ) Schematics of the experimental set-up. Histograms ( l , o ) and quantifications ( m , p ) showing Nur77 -GFP expression in the indicated P14 T cell subsets at 8 and 21 dpi. GMFI, geometric mean fluorescence intensity. Dots in graphs represent individual mice; box plots indicate range, interquartile and median; horizontal lines and error bars of bar graphs indicate mean and s.e.m. Data are representative of two independent experiments ( e , f , i , j ) and all analysed mice ( m , p ). P values are from two-tailed unpaired t-tests ( e , i , j ), two-way ANOVA ( f ), and one-way ANOVA ( m , p ); P > 0.05, not significant (n.s.).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: ( a , b ) CD4 + T cell-depleted naive mice were infected with LCMV-Cl13, treated with or without anti-PD-L1, and exhausted PD-1 + TIM-3 lo T cells were sorted at >day 30 post-infection as described . ( a ) Schematic of the experimental set-up. ( b ) Flow cytometry plots showing the sorting strategy. ( c–j ) Naive congenically marked (CD45.1 + ) Id3 -GFP P14 cells were transferred to naive recipients (Ly.5.2), which were then infected with LCMV-Docile. Splenic P14 T cells were analysed at the indicated time points after infection. ( c ) Schematic of the experimental set-up. ( d ) Flow cytometry plots showing the expression of Id3 -GFP, TCF1 and CD62L among splenic P14 T cells at 7 and 21 dpi. ( e ) Quantification showing absolute numbers of splenic CD62L + T PEX , CD62L − T PEX and total P14 cells (left) and frequencies of CD62L + cells among T PEX cells (right) at the indicated time points after infection ( f ) Flow cytometry plots showing the expression of Ly108 and CD62L and quantification of CD62L + T PEX cells among P14 T cells in the spleen, lymph nodes, blood, bone marrow and liver at day 31 post LCMV-Docile infection. ( g–j ) Histograms ( g , h ) and quantification ( i , j ) of expression of molecules as indicated in P14 T cell subsets and naive CD8 + T cells. ( k–p ) Congenically marked naive Nur77 -GFP reporter P14 T cells were transferred into naive ( k–m ) or CD4-T-cell-depleted ( n–p ) recipient mice, which were subsequently infected with LCMV-Cl13. Nur77 -GFP expression was analysed at indicated time points post-infection. ( k , n ) Schematics of the experimental set-up. Histograms ( l , o ) and quantifications ( m , p ) showing Nur77 -GFP expression in the indicated P14 T cell subsets at 8 and 21 dpi. GMFI, geometric mean fluorescence intensity. Dots in graphs represent individual mice; box plots indicate range, interquartile and median; horizontal lines and error bars of bar graphs indicate mean and s.e.m. Data are representative of two independent experiments ( e , f , i , j ) and all analysed mice ( m , p ). P values are from two-tailed unpaired t-tests ( e , i , j ), two-way ANOVA ( f ), and one-way ANOVA ( m , p ); P > 0.05, not significant (n.s.).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: Infection, Flow Cytometry, Expressing, Fluorescence, Two Tailed Test

    ( a , b ) Congenically marked naive P14 T cells were adoptively transferred into naive recipient mice, which were then infected with LCMV-Cl13. Splenic P14 T cells from each group were sorted at day 28 post-infection and restimulated independently using gp33-pulsed splenocytes in vitro . ( a ) Schematic of the experimental set-up. ( b ) Quantifications showing cytokine production of each subset after restimulation. ( c–e ) Wild-type mice were infected with LCMV-Docile and splenic CD8 + T cells were analysed at the indicated time points after infection. ( c ) Schematic of the experimental set-up. ( d ) Flow cytometry plots showing the expression of CD62L in T PEX (Ly108 hi ) and T EX (Ly108 lo ) cells among endogenous gp33-specific CD8 + T cells. ( e ) Quantification showing the proportions of CD62L-expressing cells among gp33 + T PEX cells (left) and polyclonal PD-1 + T PEX cells (right) at the indicated time points after infection ( f , g ) Congenically marked naive P14 T cells were adoptively transferred into naive recipient mice, which were then infected with LCMV-Cl13 or LCMV-Armstrong. Splenic P14 compartments from each group were sorted at 28 dpi and processed for bulk RNA-seq. ( f ) Schematic of the experimental set-up. ( g ) Principal component plot showing the transcriptional landscapes of sorted populations as indicated. ( h–j ) Congenically marked naive Tcf7 -GFP P14 T cells were adoptively transferred into naive mice, which were then infected with LCMV-Cl13. P14 T PEX cells were sorted at day 28 post-infection based on the expression of Tcf7 -GFP. ( h ) Schematic of the experimental set-up. ( i ) Flow cytometry plots showing the sorting strategy and post-sort purity. ( j ) RNA velocity analysis showing developmental trajectories of T PEX cells, together with the expression of Tcf7 (left) and Sell (right). Horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data are representative of two independent experiments ( b ) and all analysed mice ( e ). P values are from Mann–Whitney tests ( b ) and two-tailed unpaired t -tests ( e ); P > 0.05, not significant (n.s.).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: ( a , b ) Congenically marked naive P14 T cells were adoptively transferred into naive recipient mice, which were then infected with LCMV-Cl13. Splenic P14 T cells from each group were sorted at day 28 post-infection and restimulated independently using gp33-pulsed splenocytes in vitro . ( a ) Schematic of the experimental set-up. ( b ) Quantifications showing cytokine production of each subset after restimulation. ( c–e ) Wild-type mice were infected with LCMV-Docile and splenic CD8 + T cells were analysed at the indicated time points after infection. ( c ) Schematic of the experimental set-up. ( d ) Flow cytometry plots showing the expression of CD62L in T PEX (Ly108 hi ) and T EX (Ly108 lo ) cells among endogenous gp33-specific CD8 + T cells. ( e ) Quantification showing the proportions of CD62L-expressing cells among gp33 + T PEX cells (left) and polyclonal PD-1 + T PEX cells (right) at the indicated time points after infection ( f , g ) Congenically marked naive P14 T cells were adoptively transferred into naive recipient mice, which were then infected with LCMV-Cl13 or LCMV-Armstrong. Splenic P14 compartments from each group were sorted at 28 dpi and processed for bulk RNA-seq. ( f ) Schematic of the experimental set-up. ( g ) Principal component plot showing the transcriptional landscapes of sorted populations as indicated. ( h–j ) Congenically marked naive Tcf7 -GFP P14 T cells were adoptively transferred into naive mice, which were then infected with LCMV-Cl13. P14 T PEX cells were sorted at day 28 post-infection based on the expression of Tcf7 -GFP. ( h ) Schematic of the experimental set-up. ( i ) Flow cytometry plots showing the sorting strategy and post-sort purity. ( j ) RNA velocity analysis showing developmental trajectories of T PEX cells, together with the expression of Tcf7 (left) and Sell (right). Horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data are representative of two independent experiments ( b ) and all analysed mice ( e ). P values are from Mann–Whitney tests ( b ) and two-tailed unpaired t -tests ( e ); P > 0.05, not significant (n.s.).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: Infection, In Vitro, Flow Cytometry, Expressing, RNA Sequencing Assay, MANN-WHITNEY, Two Tailed Test

    ( a–d ) Single naive colour-barcoded P14 T cells were transferred to primary recipient mice, which were then infected with LCMV-Armstrong. Splenic P14 T cells were analysed at day 8 post LCMV-Armstrong infection. ( a ) Schematic of the experimental set-up for the naive P14 single-cell transfer. ( b ) Flow cytometry plots showing expression of GFP and YFP (left) or BFP/CFP and CFP/T-Sap (right) in peripheral blood of retrogenic P14 donor mice (pre-gated on CD8 + CD44 lo CD45.1 + ). ( c ) Tracking of colour-barcoded single-cell-derived progenies at 8 dpi in the spleens of three representative recipient mice. Recovered progenies were distinguished according to their combinatorial expression of GFP and YFP into populations I, II, III, IV and V, which were further subdivided by their expression of T-Sapphire, CFP, and BFP into progenies characterized by their unique combinatorial colour barcode. Note: in the display used, CFP emission appears on the diagonal between the BFP (x-axis) and T-Sapphire signal (y-axis) and is therefore indicated on both axes. ( d ) Flow cytometry plots depicting combined staining of CD45.1 and Thy1.1 with KLRG1 (upper row), or CD62L with PD-1 (lower row) for three progenies derived from adoptively transferred single naive P14 cells (grey: endogenous CD4 − CD19 − cells). ( e–i ) Colour-barcoded naive P14 T cells were transferred into primary recipient mice (R1), which were subsequently infected with LCMV-Cl13. P14 T cells were sorted at 28 dpi and single CD62L + or CD62L − T PEX cells were re-transferred into naive secondary recipient mice (R2), which were subsequently infected with LCMV-Armstrong. Splenic P14 T cells were analysed at day 8 post LCMV-Armstrong infection. ( e ) Schematic of the experimental set-up. ( f ) Percentages of transferred single cells of CD62L + T PEX , CD62L − T PEX cell or naive phenotype from which progenies were recovered at 8 dpi. ( g ) As in ( d ), but for adoptively re-transferred single CD62L + T PEX cells. ( h ) Size of single-T-cell-derived progenies and frequencies of CD62L + , KLRG1 + and ( i ) PD-1 + cells therein. Dots in graphs represent individual clones derived from a single transferred cell. Horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data show all analysed mice ( h , i ). P values are from Mann–Whitney tests ( h–i ); P > 0.05, not significant (n.s.).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: ( a–d ) Single naive colour-barcoded P14 T cells were transferred to primary recipient mice, which were then infected with LCMV-Armstrong. Splenic P14 T cells were analysed at day 8 post LCMV-Armstrong infection. ( a ) Schematic of the experimental set-up for the naive P14 single-cell transfer. ( b ) Flow cytometry plots showing expression of GFP and YFP (left) or BFP/CFP and CFP/T-Sap (right) in peripheral blood of retrogenic P14 donor mice (pre-gated on CD8 + CD44 lo CD45.1 + ). ( c ) Tracking of colour-barcoded single-cell-derived progenies at 8 dpi in the spleens of three representative recipient mice. Recovered progenies were distinguished according to their combinatorial expression of GFP and YFP into populations I, II, III, IV and V, which were further subdivided by their expression of T-Sapphire, CFP, and BFP into progenies characterized by their unique combinatorial colour barcode. Note: in the display used, CFP emission appears on the diagonal between the BFP (x-axis) and T-Sapphire signal (y-axis) and is therefore indicated on both axes. ( d ) Flow cytometry plots depicting combined staining of CD45.1 and Thy1.1 with KLRG1 (upper row), or CD62L with PD-1 (lower row) for three progenies derived from adoptively transferred single naive P14 cells (grey: endogenous CD4 − CD19 − cells). ( e–i ) Colour-barcoded naive P14 T cells were transferred into primary recipient mice (R1), which were subsequently infected with LCMV-Cl13. P14 T cells were sorted at 28 dpi and single CD62L + or CD62L − T PEX cells were re-transferred into naive secondary recipient mice (R2), which were subsequently infected with LCMV-Armstrong. Splenic P14 T cells were analysed at day 8 post LCMV-Armstrong infection. ( e ) Schematic of the experimental set-up. ( f ) Percentages of transferred single cells of CD62L + T PEX , CD62L − T PEX cell or naive phenotype from which progenies were recovered at 8 dpi. ( g ) As in ( d ), but for adoptively re-transferred single CD62L + T PEX cells. ( h ) Size of single-T-cell-derived progenies and frequencies of CD62L + , KLRG1 + and ( i ) PD-1 + cells therein. Dots in graphs represent individual clones derived from a single transferred cell. Horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data show all analysed mice ( h , i ). P values are from Mann–Whitney tests ( h–i ); P > 0.05, not significant (n.s.).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: Infection, Flow Cytometry, Expressing, Derivative Assay, Staining, Clone Assay, MANN-WHITNEY

    ( a–s ) Myb fl/fl Cd4 Cre ( Myb -cKO) mice and littermate Myb fl/fl control mice (Ctrl) were infected with either LCMV-Armstrong ( a–d ) or LCMV-Docile ( e–s ). ( a–b ) Flow cytometry plots showing ( a ) splenic antigen-specific (gp33 + ) CD8 + cells and ( b ) expression of CD62L and KLRG1 among antigen-specific cells in Myb -cKO and control mice at indicated time points post LCMV-Armstrong infection. ( c ) Quantification of central memory (T CM ), effector memory (T EM ), CX3CR1 + and KLRG1 + cells among gp33 + CD8 + cells in Myb -cKO and control mice at indicated time points post LCMV-Armstrong infection. ( d ) Numbers of splenic gp33 + CD8 + T cells in Myb -cKO and control mice at indicated time points post LCMV-Armstrong infection. ( e ) Box plots showing the weights of spleens (left) and the total numbers of splenocytes (right) in Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( f ) Spleen size (left) and haematoxylin and eosin staining of sections showing infiltration of immune cells (arrows) in livers (middle) and lungs (right) in Myb -cKO and control mice at 8 dpi. ( g ) Confocal images of F4/80 and B220 expression in frozen spleen sections and ( h ) quantification showing the cellular organization and area of lymphoid regions in Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( i ) Confocal images of CD3 and B220 expression in frozen spleen sections showing the distribution of B and T cells in the spleens of Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( j ) Image and box plot showing the size and weights of spleens in untreated and CD8 + T-cell-depleted Myb -cKO mice at day 8 post LCMV-Docile infection. ( k ) Survival curve of CD8-depleted Myb -cKO mice post LCMV-Docile infection. ( l ) Proportion of cytokine-producing antigen-specific T PEX and T EX cell subsets after gp33 peptide restimulation of Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( m , n ) Quantification of IFNγ expression ( m ), and granzyme B (GZMB) expression in T PEX and T EX cells ( n ) in Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( o ) Flow cytometry plots and quantification showing the proportions of Ki67 + within the gp33 + compartment in Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( p ) Box plots showing viral titres in the kidneys of Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( q ) Box plots showing the expression of PD-1 (left) and TIM-3 (right) among gp33 + CD8 + T cells of control and Myb -cKO mice at day 8 post LCMV-Docile infection. ( r ) Flow cytometry plots and quantification show the frequencies of T PEX cells (TCF1 + TIM-3 − ) and T EX cells (TCF1 - TIM-3 + ) among splenic gp33 + CD8 + T cells of Myb -cKO and control mice. ( s ) Quantification showing the absolute numbers of splenic CD8 + , gp33 + , CD62L + T PEX , CD62L − T PEX and T EX cells in Myb -cKO and control mice at day 8 post LCMV-Docile infection. GMFI, geometric mean fluorescence intensity. Dots in graphs represent individual mice; box plots indicate range, interquartile and median; horizontal lines in ( h ) indicate median. Data are representative of two independent experiments ( c–e , k–r ) or all mice ( j , s ) and images ( h ) analysed; P > 0.05, not significant (n.s.).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: ( a–s ) Myb fl/fl Cd4 Cre ( Myb -cKO) mice and littermate Myb fl/fl control mice (Ctrl) were infected with either LCMV-Armstrong ( a–d ) or LCMV-Docile ( e–s ). ( a–b ) Flow cytometry plots showing ( a ) splenic antigen-specific (gp33 + ) CD8 + cells and ( b ) expression of CD62L and KLRG1 among antigen-specific cells in Myb -cKO and control mice at indicated time points post LCMV-Armstrong infection. ( c ) Quantification of central memory (T CM ), effector memory (T EM ), CX3CR1 + and KLRG1 + cells among gp33 + CD8 + cells in Myb -cKO and control mice at indicated time points post LCMV-Armstrong infection. ( d ) Numbers of splenic gp33 + CD8 + T cells in Myb -cKO and control mice at indicated time points post LCMV-Armstrong infection. ( e ) Box plots showing the weights of spleens (left) and the total numbers of splenocytes (right) in Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( f ) Spleen size (left) and haematoxylin and eosin staining of sections showing infiltration of immune cells (arrows) in livers (middle) and lungs (right) in Myb -cKO and control mice at 8 dpi. ( g ) Confocal images of F4/80 and B220 expression in frozen spleen sections and ( h ) quantification showing the cellular organization and area of lymphoid regions in Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( i ) Confocal images of CD3 and B220 expression in frozen spleen sections showing the distribution of B and T cells in the spleens of Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( j ) Image and box plot showing the size and weights of spleens in untreated and CD8 + T-cell-depleted Myb -cKO mice at day 8 post LCMV-Docile infection. ( k ) Survival curve of CD8-depleted Myb -cKO mice post LCMV-Docile infection. ( l ) Proportion of cytokine-producing antigen-specific T PEX and T EX cell subsets after gp33 peptide restimulation of Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( m , n ) Quantification of IFNγ expression ( m ), and granzyme B (GZMB) expression in T PEX and T EX cells ( n ) in Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( o ) Flow cytometry plots and quantification showing the proportions of Ki67 + within the gp33 + compartment in Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( p ) Box plots showing viral titres in the kidneys of Myb -cKO and control mice at day 8 post LCMV-Docile infection. ( q ) Box plots showing the expression of PD-1 (left) and TIM-3 (right) among gp33 + CD8 + T cells of control and Myb -cKO mice at day 8 post LCMV-Docile infection. ( r ) Flow cytometry plots and quantification show the frequencies of T PEX cells (TCF1 + TIM-3 − ) and T EX cells (TCF1 - TIM-3 + ) among splenic gp33 + CD8 + T cells of Myb -cKO and control mice. ( s ) Quantification showing the absolute numbers of splenic CD8 + , gp33 + , CD62L + T PEX , CD62L − T PEX and T EX cells in Myb -cKO and control mice at day 8 post LCMV-Docile infection. GMFI, geometric mean fluorescence intensity. Dots in graphs represent individual mice; box plots indicate range, interquartile and median; horizontal lines in ( h ) indicate median. Data are representative of two independent experiments ( c–e , k–r ) or all mice ( j , s ) and images ( h ) analysed; P > 0.05, not significant (n.s.).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: Infection, Flow Cytometry, Expressing, Staining, Fluorescence

    ( a–n ) Naive CD45.1 mice were lethally irradiated and reconstituted using a mixture of Myb fl/fl Cd4 Cre ( Myb -cKO) and Cd4 Cre or littermate Myb fl/fl control (Ctrl) bone marrow. Chimeric mice were subsequently infected with LCMV-Docile and analysed at the indicated time points after infection. Quantification showing the frequencies of ( a ) polyclonal antigen-specific gp33 + cells among Myb -cKO and control CD8 + T cells at 8 dpi. ( b ) Flow cytometry plots and quantification of IFNγ + cells among Myb -cKO and control CD8 + T cells after peptide restimulation in vitro at 8 dpi. ( c ) Quantification of GZMB expression among gp33 + cells of the indicated genotypes. ( d , e ) Flow cytometry plots and quantification showing the frequencies of ( d ) Ki67 + cells and ( e ) annexin-V + cells among Myb -cKO and control antigen-responsive CD8 + T cells. ( f , g ) Flow cytometry plots and quantification showing the frequencies of TCF1 + T PEX cells among antigen-specific T cells ( f ) and CD62L + cells among T PEX cells ( g ) in Myb -cKO and control compartments at 8 dpi. ( h ) Flow cytometry plots showing the frequencies of T PEX cells among gp33 + cells at 49 dpi. ( i–j ) Flow cytometry plots ( i ) and quantification ( j ) showing kinetics of splenic polyclonal PD-1 + T PEX cells among Myb -cKO and control CD8 + T cells after infection. ( k–l ) Flow cytometry plots ( k ) and quantification (l) showing the frequencies of the entire antigen-responsive PD-1 + cell compartment among Myb -cKO and control CD8 + T cells at indicated time points after infection. ( m , n ) Flow cytometry plots and quantifications showing the frequencies of Ki67 + cells among Myb -cKO and control polyclonal T PEX ( m ) and T EX ( n ) cells at indicated time points after infection. GMFI, geometric mean fluorescence intensity. Dots in graphs represent individual mice; box plots indicate range, interquartile and median. Symbols and error bars represent mean and s.e.m., respectively. All data are representative of two independent experiments. P values are from two-tailed unpaired t -tests ( a–g ) and Mann–Whitney tests ( j–n ); P > 0.05, not significant (n.s.).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: ( a–n ) Naive CD45.1 mice were lethally irradiated and reconstituted using a mixture of Myb fl/fl Cd4 Cre ( Myb -cKO) and Cd4 Cre or littermate Myb fl/fl control (Ctrl) bone marrow. Chimeric mice were subsequently infected with LCMV-Docile and analysed at the indicated time points after infection. Quantification showing the frequencies of ( a ) polyclonal antigen-specific gp33 + cells among Myb -cKO and control CD8 + T cells at 8 dpi. ( b ) Flow cytometry plots and quantification of IFNγ + cells among Myb -cKO and control CD8 + T cells after peptide restimulation in vitro at 8 dpi. ( c ) Quantification of GZMB expression among gp33 + cells of the indicated genotypes. ( d , e ) Flow cytometry plots and quantification showing the frequencies of ( d ) Ki67 + cells and ( e ) annexin-V + cells among Myb -cKO and control antigen-responsive CD8 + T cells. ( f , g ) Flow cytometry plots and quantification showing the frequencies of TCF1 + T PEX cells among antigen-specific T cells ( f ) and CD62L + cells among T PEX cells ( g ) in Myb -cKO and control compartments at 8 dpi. ( h ) Flow cytometry plots showing the frequencies of T PEX cells among gp33 + cells at 49 dpi. ( i–j ) Flow cytometry plots ( i ) and quantification ( j ) showing kinetics of splenic polyclonal PD-1 + T PEX cells among Myb -cKO and control CD8 + T cells after infection. ( k–l ) Flow cytometry plots ( k ) and quantification (l) showing the frequencies of the entire antigen-responsive PD-1 + cell compartment among Myb -cKO and control CD8 + T cells at indicated time points after infection. ( m , n ) Flow cytometry plots and quantifications showing the frequencies of Ki67 + cells among Myb -cKO and control polyclonal T PEX ( m ) and T EX ( n ) cells at indicated time points after infection. GMFI, geometric mean fluorescence intensity. Dots in graphs represent individual mice; box plots indicate range, interquartile and median. Symbols and error bars represent mean and s.e.m., respectively. All data are representative of two independent experiments. P values are from two-tailed unpaired t -tests ( a–g ) and Mann–Whitney tests ( j–n ); P > 0.05, not significant (n.s.).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: Irradiation, Infection, Flow Cytometry, In Vitro, Expressing, Fluorescence, Two Tailed Test, MANN-WHITNEY

    ( a–g ) Congenically marked naive control ( Cd4 Cre ) and Myb fl/fl Cd4 Cre ( Myb -cKO) P14 T cells were adoptively transferred into naive recipient mice, which were subsequently infected with LCMV-Docile. Splenic P14 T cells were analysed at indicated time points post-infection (p.i). ( a ) Schematic of the experimental set-up. ( b ) Box plot showing PD-1 expression of transferred P14 cells at 8 dpi. ( c ) Flow cytometry plots and quantification showing frequencies of CD62L + cells among Myb -cKO and control P14 T PEX cells. ( d ) Flow cytometry plots and quantification showing the expression of granzyme B (GZMB) in Myb -cKO and control T EX P14 cells at 8 dpi. ( e ) Flow cytometry plots and quantifications showing the production of cytokines as indicated from Myb -cKO and control P14 T cells after gp33 peptide restimulation at 8 dpi. ( f ) Flow cytometry plots and quantification showing the frequencies of T PEX cells among Myb -cKO and control P14 T cells at the indicated time points after infection. ( g ) Flow cytometry plots and quantification showing the frequencies of Ki67 + cells among Myb -cKO and control P14 T cells at indicated time points after infection. GMFI, geometric mean fluorescence intensity. Dots in graphs represent individual mice; box plots indicate range, interquartile and median; Data are representative of two independent experiments ( b–g ). P values are from two-tailed unpaired t -tests; P > 0.05, not significant (n.s.).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: ( a–g ) Congenically marked naive control ( Cd4 Cre ) and Myb fl/fl Cd4 Cre ( Myb -cKO) P14 T cells were adoptively transferred into naive recipient mice, which were subsequently infected with LCMV-Docile. Splenic P14 T cells were analysed at indicated time points post-infection (p.i). ( a ) Schematic of the experimental set-up. ( b ) Box plot showing PD-1 expression of transferred P14 cells at 8 dpi. ( c ) Flow cytometry plots and quantification showing frequencies of CD62L + cells among Myb -cKO and control P14 T PEX cells. ( d ) Flow cytometry plots and quantification showing the expression of granzyme B (GZMB) in Myb -cKO and control T EX P14 cells at 8 dpi. ( e ) Flow cytometry plots and quantifications showing the production of cytokines as indicated from Myb -cKO and control P14 T cells after gp33 peptide restimulation at 8 dpi. ( f ) Flow cytometry plots and quantification showing the frequencies of T PEX cells among Myb -cKO and control P14 T cells at the indicated time points after infection. ( g ) Flow cytometry plots and quantification showing the frequencies of Ki67 + cells among Myb -cKO and control P14 T cells at indicated time points after infection. GMFI, geometric mean fluorescence intensity. Dots in graphs represent individual mice; box plots indicate range, interquartile and median; Data are representative of two independent experiments ( b–g ). P values are from two-tailed unpaired t -tests; P > 0.05, not significant (n.s.).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: Infection, Expressing, Flow Cytometry, Fluorescence, Two Tailed Test

    ( a , b ) Congenically marked Myb fl/fl Cd4 Cre ( Myb -cKO, CD45.2 + ) and Cd4 Cre (Ctrl, CD45.2 + or CD45.2 + CD45.1 + ) P14 T cells were adoptively transferred into separate naive recipient (CD45.1) mice, which were then infected with LCMV-Docile. Splenic P14 T PEX cells were sorted at day 7 post-infection and processed for bulk RNA-seq. ( a ) Schematic of the experimental set-up. ( b ) Gene set enrichment analysis showing loss of CD62L + T PEX transcriptional signature in Myb -cKO T PEX cells compared to control T PEX cells. ( c ) Volcano plots highlighting genes differentially expressed (FDR < 0.15) between control CD62L + T PEX and CD62L − T PEX cells. ( d–e ) Mixed bone marrow chimeric mice containing congenically marked Myb -cKO and control CD8 + T cells were infected with LCMV-Docile. Flow cytometry plots ( d ) and quantification ( e ) showing the frequencies of the entire antigen-responsive PD-1 + cell compartment among Myb -cKO and control CD8 + T cells in the spleen and lymph nodes at day 70 post-infection. ( f , g ) Congenically marked Myb -cKO and Ctrl P14 T cells were adoptively transferred into separate naive recipient mice, which were then infected with LCMV-Docile. Splenic P14 T PEX cells were analysed at day 8 post-infection. ( f ) Schematic of the experimental set-up. ( g ) Quantification showing the abundances of the indicated P14 subsets per spleen. ( h ) Heat map depicting genes differentially expressed (FDR < 0.15, FC > 1) between control CD62L + T PEX and CD62L − T PEX cell or Myb -cKO and control T PEX and T EX cells, with genes of interest annotated. ( i ) Gene set enrichment analysis showing loss of CX3CR1 + T EX transcriptional signature in P14 Myb -cKO T EX cells compared to control T EX cells. ( j ) Volcano plot highlighting genes differentially expressed (FDR < 0.15) between control and Myb -cKO T EX cells with genes of interested annotated. ( k ) Flow cytometry plots and quantification show the frequencies of CX3CR1 + cells among control and Myb -cKO T EX P14 T cells at day 8 post LCMV-Docile infection. ( l ) Flow cytometry plots and quantifications showing CX3CR1 and CD101 expression in Myb -cKO and control T EX cells at the indicated time points after infection. Dots in graph represent individual mice; box plots indicate range, interquartile and median. Symbols and error bars in ( l ) represent mean and s.e.m., respectively Data are representative of two independent experiments ( e , g , k , l ). P values are from two-tailed unpaired t -tests; P > 0.05, not significant (n.s.).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: ( a , b ) Congenically marked Myb fl/fl Cd4 Cre ( Myb -cKO, CD45.2 + ) and Cd4 Cre (Ctrl, CD45.2 + or CD45.2 + CD45.1 + ) P14 T cells were adoptively transferred into separate naive recipient (CD45.1) mice, which were then infected with LCMV-Docile. Splenic P14 T PEX cells were sorted at day 7 post-infection and processed for bulk RNA-seq. ( a ) Schematic of the experimental set-up. ( b ) Gene set enrichment analysis showing loss of CD62L + T PEX transcriptional signature in Myb -cKO T PEX cells compared to control T PEX cells. ( c ) Volcano plots highlighting genes differentially expressed (FDR < 0.15) between control CD62L + T PEX and CD62L − T PEX cells. ( d–e ) Mixed bone marrow chimeric mice containing congenically marked Myb -cKO and control CD8 + T cells were infected with LCMV-Docile. Flow cytometry plots ( d ) and quantification ( e ) showing the frequencies of the entire antigen-responsive PD-1 + cell compartment among Myb -cKO and control CD8 + T cells in the spleen and lymph nodes at day 70 post-infection. ( f , g ) Congenically marked Myb -cKO and Ctrl P14 T cells were adoptively transferred into separate naive recipient mice, which were then infected with LCMV-Docile. Splenic P14 T PEX cells were analysed at day 8 post-infection. ( f ) Schematic of the experimental set-up. ( g ) Quantification showing the abundances of the indicated P14 subsets per spleen. ( h ) Heat map depicting genes differentially expressed (FDR < 0.15, FC > 1) between control CD62L + T PEX and CD62L − T PEX cell or Myb -cKO and control T PEX and T EX cells, with genes of interest annotated. ( i ) Gene set enrichment analysis showing loss of CX3CR1 + T EX transcriptional signature in P14 Myb -cKO T EX cells compared to control T EX cells. ( j ) Volcano plot highlighting genes differentially expressed (FDR < 0.15) between control and Myb -cKO T EX cells with genes of interested annotated. ( k ) Flow cytometry plots and quantification show the frequencies of CX3CR1 + cells among control and Myb -cKO T EX P14 T cells at day 8 post LCMV-Docile infection. ( l ) Flow cytometry plots and quantifications showing CX3CR1 and CD101 expression in Myb -cKO and control T EX cells at the indicated time points after infection. Dots in graph represent individual mice; box plots indicate range, interquartile and median. Symbols and error bars in ( l ) represent mean and s.e.m., respectively Data are representative of two independent experiments ( e , g , k , l ). P values are from two-tailed unpaired t -tests; P > 0.05, not significant (n.s.).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: Infection, RNA Sequencing Assay, Flow Cytometry, Expressing, Two Tailed Test

    ( a–d ) Representative tracks showing MYB ChIP–seq peaks in the LEF1 ( a ), E2F1 ( b ), GZMA ( c ), and MYB ( d ) gene loci of human Jurkat T cells and ATAC-seq peaks of T PEX and T EX cells in the corresponding mouse gene loci aligned according to the sequence conservation. ( e–g ) Congenically marked naive P14 cells were transferred to primary recipient mice (R1), which were subsequently infected with LCMV-Cl13. The indicated subsets of P14 cells were sorted at 28 dpi and re-transferred to naive secondary recipient mice (R2), which were then infected with LCMV-Armstrong. Splenic P14 T cells in R2 mice were analysed at 8 dpi. ( e ) Schematic of the experimental set-up. ( f ) Flow cytometry plots of progenies recovered at 8 dpi. ( g ) Cell numbers (left) and quantification of PD-1 expression (right) in P14 T cell populations derived from the indicated transferred subsets at 8 dpi. ( h , i ) Congenically marked naive P14 T cells were transferred into primary recipient mice (R1), which were then infected with LCMV-Docile. The indicated subsets of P14 T cells were sorted at 7 dpi and 7.5×10 4 cells were re-transferred to infection-matched (LCMV-Docile) secondary recipient mice (R2). Splenic P14 T cells of R2 mice were analysed at day 28 post re-transfer. ( h ) Schematic of the experimental set-up. ( i ) Flow cytometry plots and box plots showing the frequencies of CX3CR1 + and CD101 + cells among recovered T EX cells derived from the indicated re-transferred T PEX subsets at day 28 post re-transfer. Data are representative of two independent experiments. P values are from Mann–Whitney tests ( g ) and two-tailed unpaired t -test ( i ); P > 0.05, not significant (n.s.).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: ( a–d ) Representative tracks showing MYB ChIP–seq peaks in the LEF1 ( a ), E2F1 ( b ), GZMA ( c ), and MYB ( d ) gene loci of human Jurkat T cells and ATAC-seq peaks of T PEX and T EX cells in the corresponding mouse gene loci aligned according to the sequence conservation. ( e–g ) Congenically marked naive P14 cells were transferred to primary recipient mice (R1), which were subsequently infected with LCMV-Cl13. The indicated subsets of P14 cells were sorted at 28 dpi and re-transferred to naive secondary recipient mice (R2), which were then infected with LCMV-Armstrong. Splenic P14 T cells in R2 mice were analysed at 8 dpi. ( e ) Schematic of the experimental set-up. ( f ) Flow cytometry plots of progenies recovered at 8 dpi. ( g ) Cell numbers (left) and quantification of PD-1 expression (right) in P14 T cell populations derived from the indicated transferred subsets at 8 dpi. ( h , i ) Congenically marked naive P14 T cells were transferred into primary recipient mice (R1), which were then infected with LCMV-Docile. The indicated subsets of P14 T cells were sorted at 7 dpi and 7.5×10 4 cells were re-transferred to infection-matched (LCMV-Docile) secondary recipient mice (R2). Splenic P14 T cells of R2 mice were analysed at day 28 post re-transfer. ( h ) Schematic of the experimental set-up. ( i ) Flow cytometry plots and box plots showing the frequencies of CX3CR1 + and CD101 + cells among recovered T EX cells derived from the indicated re-transferred T PEX subsets at day 28 post re-transfer. Data are representative of two independent experiments. P values are from Mann–Whitney tests ( g ) and two-tailed unpaired t -test ( i ); P > 0.05, not significant (n.s.).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: ChIP-sequencing, Sequencing, Infection, Flow Cytometry, Expressing, Derivative Assay, MANN-WHITNEY, Two Tailed Test

    a , b , Congenically marked naive P14 T cells were transferred into primary recipient (R1) mice, which were subsequently infected with LCMV-Cl13. Exhausted T cell subsets were sorted at 28 dpi and 1.0 × 10 4 –2.5 × 10 4 cells or no cells (Nil) were re-transferred into secondary Tcra −/ − recipient (R2) mice. Splenic P14 T cells of R2 mice were analysed 8 days after infection with LCMV-Armstrong. a , Schematic of the experimental set-up. b , Numbers of recovered P14 T cells (left), percentages of KLRG1 + (middle) and splenic viral loads (right). PFU, plaque-forming units. c – e , Congenically marked naive P14 T cells were transferred into CD4-depleted R1 mice, which were subsequently infected with LCMV-Cl13. Exhausted T cell subsets were sorted at 28 dpi and re-transferred to infection-matched CD4-depleted (CD4 Δ) R2 mice, treated with anti-PD-L1 antibodies or phosphate-buffered saline (PBS) on days 1, 4, 7, 10 and 13 and analysed at day 14 after re-transfer. c , Schematic of the experimental set-up. d , Representative flow cytometry plots of splenic progeny derived from transferred T cell subsets after treatment with anti-PD-L1, at day 14 after re-transfer (cells were gated on CD4 − CD19 − PD-1 + cells). Box plots show the relative progeny expansion in anti-PD-L1-treated versus PBS-treated mice (left) and the numbers of CD62L + T PEX cells among progeny after anti-PD-L1 treatment (right). e , Average subset distribution. f – h , Mixed bone marrow chimeric mice containing congenically marked Myb -cKO and Cd4 Cre (control) T cells, infected with LCMV-Docile, were treated with anti-PD-L1 on days 33, 36, 39, 42 and 45 and analysed at 49 dpi. f , Schematic of the experimental set-up. g , h , Representative flow cytometry plots ( g ) and box plot ( h ) showing the fold change of frequencies of splenic polyclonal PD1 + CD8 + T cells in anti-PD-L1-treated versus PBS-treated mice. Cells were gated on CD8 + cells; 49 dpi. Dots in graphs represent individual mice; box plots indicate minimum and maximum values (whiskers), interquartile range (box limits) and median (centre line); horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data are representative of at least two independent experiments ( b , d–e , g – h ). P values are from two-tailed unpaired t -tests ( b (middle), h ) and Mann–Whitney tests ( b (left, right, d ).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: a , b , Congenically marked naive P14 T cells were transferred into primary recipient (R1) mice, which were subsequently infected with LCMV-Cl13. Exhausted T cell subsets were sorted at 28 dpi and 1.0 × 10 4 –2.5 × 10 4 cells or no cells (Nil) were re-transferred into secondary Tcra −/ − recipient (R2) mice. Splenic P14 T cells of R2 mice were analysed 8 days after infection with LCMV-Armstrong. a , Schematic of the experimental set-up. b , Numbers of recovered P14 T cells (left), percentages of KLRG1 + (middle) and splenic viral loads (right). PFU, plaque-forming units. c – e , Congenically marked naive P14 T cells were transferred into CD4-depleted R1 mice, which were subsequently infected with LCMV-Cl13. Exhausted T cell subsets were sorted at 28 dpi and re-transferred to infection-matched CD4-depleted (CD4 Δ) R2 mice, treated with anti-PD-L1 antibodies or phosphate-buffered saline (PBS) on days 1, 4, 7, 10 and 13 and analysed at day 14 after re-transfer. c , Schematic of the experimental set-up. d , Representative flow cytometry plots of splenic progeny derived from transferred T cell subsets after treatment with anti-PD-L1, at day 14 after re-transfer (cells were gated on CD4 − CD19 − PD-1 + cells). Box plots show the relative progeny expansion in anti-PD-L1-treated versus PBS-treated mice (left) and the numbers of CD62L + T PEX cells among progeny after anti-PD-L1 treatment (right). e , Average subset distribution. f – h , Mixed bone marrow chimeric mice containing congenically marked Myb -cKO and Cd4 Cre (control) T cells, infected with LCMV-Docile, were treated with anti-PD-L1 on days 33, 36, 39, 42 and 45 and analysed at 49 dpi. f , Schematic of the experimental set-up. g , h , Representative flow cytometry plots ( g ) and box plot ( h ) showing the fold change of frequencies of splenic polyclonal PD1 + CD8 + T cells in anti-PD-L1-treated versus PBS-treated mice. Cells were gated on CD8 + cells; 49 dpi. Dots in graphs represent individual mice; box plots indicate minimum and maximum values (whiskers), interquartile range (box limits) and median (centre line); horizontal lines and error bars of bar graphs indicate mean and s.e.m., respectively. Data are representative of at least two independent experiments ( b , d–e , g – h ). P values are from two-tailed unpaired t -tests ( b (middle), h ) and Mann–Whitney tests ( b (left, right, d ).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: Infection, Flow Cytometry, Derivative Assay, Two Tailed Test, MANN-WHITNEY

    ( a–f ) Congenically marked PD-1-deficient ( Pdcd1 −/− ) and control P14 T cells were transferred to naive mice, which were subsequently infected with LCMV-Docile. Splenic P14 T cells were analysed at 7 dpi. ( a ) Schematic of the experimental set-up. ( b ) P14 T cell frequencies and numbers of indicated genotypes. ( c ) Flow cytometry plots and frequencies of T PEX (Ly108 hi TIM-3 lo ) and T EX (Ly108 lo TIM-3 hi ) cells. ( d ) Box plots show frequencies and numbers of CD62L + T PEX cells among control and PD-1-deficient P14 cells. Flow cytometry plots and box plots show ( e ) frequencies of KIT + T PEX cells and ( f ) numbers of KIT + T PEX and T EX cells per spleen. ( g–k ) Wild-type mice were infected with LCMV-Docile and treated with anti-PD-L1 at 200 μg/mouse at 1, 3 and 5 dpi. Splenic CD8 + T cells were analysed at 6 dpi. ( g ) Schematic of the experimental set-up. ( h ) Flow cytometry plots and quantification showing the frequencies of PD-1 + cells among splenic CD8 + T cells. ( i–j ) Flow cytometry plots ( i ) and quantification ( j ) showing expression of CD62L among polyclonal T PEX cells (Ly108 hi TIM-3 lo ). ( k ) Quantification showing the population sizes of CD62L + T PEX , CD62L − T PEX and T EX cells among total CD8 + T cells in untreated and anti-PD-L1-treated mice. ( l–p ) Wild-type mice were infected with LCMV-Docile and treated with anti-PD-L1 at 200 μg/mouse at 21, 23, 25, 27 and 29 dpi. Splenic CD8 + T cells were analysed at 31 dpi. ( l ) Schematic of the experimental set-up. ( m–n ) Flow cytometry plots ( m ) and quantification ( n ) showing the frequencies of the PD-1 + cells among splenic CD8 + T cells. ( o ) Flow cytometry plots and quantification showing the expression of CD62L among polyclonal T PEX cells (Ly108 hi TIM-3 lo ). ( p ) Quantification showing the population sizes of CD62L + T PEX , CD62L − T PEX and T EX cells among total CD8 + T cells in untreated and anti-PD-L1-treated mice. Dots in graphs represent individual mice; box plots indicate range, interquartile and median. Data are representative of at least two independent experiments. P values are from two-tailed unpaired t -tests; P > 0.05, not significant (n.s.).

    Journal: Nature

    Article Title: MYB orchestrates T cell exhaustion and response to checkpoint inhibition

    doi: 10.1038/s41586-022-05105-1

    Figure Lengend Snippet: ( a–f ) Congenically marked PD-1-deficient ( Pdcd1 −/− ) and control P14 T cells were transferred to naive mice, which were subsequently infected with LCMV-Docile. Splenic P14 T cells were analysed at 7 dpi. ( a ) Schematic of the experimental set-up. ( b ) P14 T cell frequencies and numbers of indicated genotypes. ( c ) Flow cytometry plots and frequencies of T PEX (Ly108 hi TIM-3 lo ) and T EX (Ly108 lo TIM-3 hi ) cells. ( d ) Box plots show frequencies and numbers of CD62L + T PEX cells among control and PD-1-deficient P14 cells. Flow cytometry plots and box plots show ( e ) frequencies of KIT + T PEX cells and ( f ) numbers of KIT + T PEX and T EX cells per spleen. ( g–k ) Wild-type mice were infected with LCMV-Docile and treated with anti-PD-L1 at 200 μg/mouse at 1, 3 and 5 dpi. Splenic CD8 + T cells were analysed at 6 dpi. ( g ) Schematic of the experimental set-up. ( h ) Flow cytometry plots and quantification showing the frequencies of PD-1 + cells among splenic CD8 + T cells. ( i–j ) Flow cytometry plots ( i ) and quantification ( j ) showing expression of CD62L among polyclonal T PEX cells (Ly108 hi TIM-3 lo ). ( k ) Quantification showing the population sizes of CD62L + T PEX , CD62L − T PEX and T EX cells among total CD8 + T cells in untreated and anti-PD-L1-treated mice. ( l–p ) Wild-type mice were infected with LCMV-Docile and treated with anti-PD-L1 at 200 μg/mouse at 21, 23, 25, 27 and 29 dpi. Splenic CD8 + T cells were analysed at 31 dpi. ( l ) Schematic of the experimental set-up. ( m–n ) Flow cytometry plots ( m ) and quantification ( n ) showing the frequencies of the PD-1 + cells among splenic CD8 + T cells. ( o ) Flow cytometry plots and quantification showing the expression of CD62L among polyclonal T PEX cells (Ly108 hi TIM-3 lo ). ( p ) Quantification showing the population sizes of CD62L + T PEX , CD62L − T PEX and T EX cells among total CD8 + T cells in untreated and anti-PD-L1-treated mice. Dots in graphs represent individual mice; box plots indicate range, interquartile and median. Data are representative of at least two independent experiments. P values are from two-tailed unpaired t -tests; P > 0.05, not significant (n.s.).

    Article Snippet: Cas9 Nuclease (Integrated DNA Technologies) and a previously described Pdcd1 -targeting sgRNA (Synthego) using the P3 primary cell 4D-Nucleofector X kit S electroporation kit (Lonza) and Lonza 4D-Nucleofector Core Unit (Lonza).

    Techniques: Infection, Flow Cytometry, Expressing, Two Tailed Test